Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT20849.3                            5 END     5          71      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 389.0    0Xt7.1-TNeu089h08.3                         32 PI      76        391     1089                XPtx2a [Xenopus laevis]
     3 238.0    0Xt7.1-CABH8866.3                            9 PI      76        406      824                homeodomain transcription factor Pitx-3 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012091412 Xt7.1-TTbA052m02.5 - 7 ESTs
                                                                       ......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA052m02.5                                                                                                                                                                                                                                                                                                                                                                               ACATGCATGCCTGGGAACCTGCAGCCACCGATCTGCTGAAAGGAAGACGAAATAAAAAAGGGGAAAACTTCTGTAAAGGCGTTTCCATGGGCCGCCACCCTGAGAAGGGCAGAAAGTGGATTTGATTTGGTTGGTGTAGGATTTTGTGGAATACGCGTTTCATGAGCAGAGTGATTTACCATGGATTCCTTTAAAGGAGCTATGAATTTGGAAAGATTGCCTGAGAGTTTAAGACCCCAGCCTTCCCACGACATGGCCACTAGTTTCCATTTGCAGCGATCATCTGAAGCCAGGGATCCCATGGACAATTCAGCCAGTGAGTCTTCTGATACTGAAATCGCAGAGAAAGAACGAAGTGGGGAGCCAAAGGGAGAGGACGGCAATGGGGATGATCCCACAAAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAACCAGCAGATGGACCTGTGCAAGAATGGCTACGTGCCCCAGTTCAGCGGCCTGATGCAGCCCTACGATGAGATGTACGCTGGCTACCCGTACAACAACTGGGCCACCAAAAGCCTCACCCCTGCCCCCCTGTCCACCAAGAGCTTCACCTTCTTCAACTCCATGAGTCCGCTGTCCTCCCAGTCCATGTTCTCTGGCCCCAGCTCCATCTCTTCCATGAGCATGCCCTCCAGCATGGGCCACTCGGCGGTGCCCGGCATGCCCAACTCTAGTCTTAACAACATCAACAACCTTAATAACATCAGCAGCTCCTCCCTCAACTCCGCCATGTCTTCTACTGCTTGTCCCTATGGCCCCCCCGGCTCCCCATACACGGTATACAGGGACACTTGTAACTCGAGTTTGGCCAGCCTGAGACTGAAATCCAAGCAGCACTCCACCTTTGGCTACAGTAGCCTGCAGAGCCCGGCCTCCAGCCTCAATGCCTGCCAGTATAACAGTTGATAGACTCCCCAGCTGTGTGCCAACCCTGTGGACTCTCACAATGGACCAGACAATACTTTTTGTGCAAGACACCGAATCTAAGAACACATGGATGAGTTGCAATTTTTCTCTGGATTATGCGGGTTGTATGTGTTTACTTTGACTTGCACA
                                                  Xt7.1-CHK-1008239386                                                                                                                                                                                                                                                                                                                                                                                     ATGCCTGGGAACCTGCAGCCACCGATCTGCTGAAAGGAAGACGAAATAAAAAAGGGGAAAACTTCTGTAAAGGCGTTTCCATGGGCCGCCACCCTGAGAAGGGCAGAAAGTGGATTTGATTTGGTTGGTGTAGGATTTTGTGGAATACGCGTTTCATGAGCAGAGTGATTTACCATGGATTCCTTTAAAGGAGCTATGAATTTGGAAAGATTGCCTGAGAGTTTAAGACCCCAGCCTTCCCACGACATGGCCACTAGTTTCCATTTGCAGCGATCATCTGAAGCCAGGGATCCCATGGACAATTCAGCCAGTGAGTCTTCTGATACTGAAATCGCAGAGAAAGAACGAAGTGGGGAGCCAAAGGGAGAGGACGGCAATGGGGATGATCCCACAAAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAACCAGCAGATGGACCTGTGCAAGAATGGCTACGTGCCCCAGTTCAGCGGCCTGATGCAGCCCTACGATGAGATGTACGCTGGCTACCCGTACAACAACTGGGCCACCAAAAGCCTCACCCCTGCCCCCCTGTCCACCAAGAGCTTCACCTTCTTCAACTCCATGAGTCCGCTGTCCTCCCAGTCCATGTTCTCTGGCCCCAGCTCCATCTCTTCCATGAGCATGCCCTCCAGCATGGGCCACTCGGCGGTGCCCGGCATGCCCAACTCTAGTCTTAACAACATCAACAACCTTAATAACATCAGCAGCTCCTCCCTCAACTCCGCCATGTCTTCTACTGCTTGTCCCTATGGCCCCCCCGGCTCCCCATACACGGTATACAGGGACACTTGTAACTCGAGTTTGGCCAGCCTGAGACTGAAATCCAAGCAGCACTCCACCTTTGGCTACAGTAGCCTGCAGAGCCCGGCCTCCAGCCTCAATGCCTGCCAGTATAACAGTTGATAGACTCCCCAGCTGTGTGCCAACCCTGTGGACTCTCACAATGGACCAGACAATACTTTTTGTGCAAGACACCGAATCTAAGAACACATGGATGAGTTGCAATTTTTCTCTGGATTATGCGGGTTGTATGTGTTTACTTTGACTTGCACAGAAGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     3     2     3     3     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                               BLH ATG     180     323                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN     180     154                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR     180     402                                                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG     180      19                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sc ---- 8e-011     NP_010177.1 Regulation of phosphate metabolism; Pho2p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Br ==== 3e-018     ABD62780.1 Rx homeobox protein [Branchiostoma lanceolatum] =============================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Cs ---- 3e-018     BAB68341.1 Cs-OTX [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 4e-027     NP_001021276.1 UNCoordinated family member (unc-30) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Bf ==== 4e-054     CAD27489.1 paired superclass homeobox transcription factor [Branchiostoma floridae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 9e-053     NP_733410.2 CG1447-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                         PROTEIN --- Ci ---- 5e-055     AAU93886.1 pituitary homeobox pitx isoform a/b [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 5e-060     XP_797336.2 PREDICTED: similar to paired superclass homeobox transcription factor HpPitx [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bb ==== 6e-065     AAF03901.1 bicoid type transcription factor Pitx [Branchiostoma belcheri] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 1e-132     NP_001035436.1 hypothetical protein LOC678598 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 2e-139     NP_035227.1 paired-like homeodomain transcription factor 1 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 8e-142     NP_002644.3 paired-like homeodomain transcription factor 1; hindlimb expressed homeoboxprotein backfoot; pituitary homeo box 1; pituitary otx-related factor [Homosapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Gg ==== 3e-161     XP_414626.2 PREDICTED: similar to paired-like homeodomain transcription factor Ptx1 isoform 3 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 9e-176     AAF29531.1 pituitary homeobox gene 1 paired-like homeodomain transcription factor [Xenopuslaevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 9e-176     NP_001080981.1 pituitary homeobox gene 1 paired-likehomeodomain transcription factor [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 2e-178     NP_001007500.1 pitx1-prov protein [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA052m02.5                                                                                                                                                                                                                                                                                                                                                                                     ATG---------------------------TGA---------------------------------------------------------------------------------------------------------------------------TGA------TGA------ATG------------------ATG------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------ATG---------------------ATG---------------------------ATG---ATG---------ATG---------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATAG---------------------------------------------------------------------------TAA------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   1           Tbd0 FL                     IMAGE:6979090.FL-MGC                                                                                                                                                                                                                                                                                                                                                       GGCTAGCAAGTCCAGCACTCTCATACATGCATGCCTGGGAACCTGCAGCCACCGATCTGCTGAAAGGAAGACGAAATAAAAAAGGGGAAAACTTCTGTAAAGGCGTTTCCATGGGCCGCCACCCTGAGAAGGGCAGAAAGTGGATTTGATTTGGTTGGTGTAGGATTTTGTGGAATACGCGTTTCATGAGCAGAGTGATTTACCATGGATTCCTTTAAAGGAGCTATGAATTTGGAAAGATTGCCTGAGAGTTTAAGACCCCAGCCTTCCCACGACATGGCCACTAGTTTCCATTTGCAGCGATCATCTGAAGCCAGGGATCCCATGGACAATTCAGCCAGTGAGTCTTCTGATACTGAAATCGCAGAGAAAGAACGAAGTGGGGAGCCAAAGGGAGAGGACGGCAATGGGGATGATCCCACAAAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAACCAGCAGATGGACCTGTGCAAGAATGGCTACGTGCCCCAGTTCAGCGGCCTGATGCAGCCCTACGATGAGATGTACGCTGGCTACCCGTACAACAACTGGGCCACCAAAAGCCTCACCCCTGCCCCCCTGTCCACCAAGAGCTTCACCTTCTTCAACTCCATGAGTCCGCTGTCCTCCCAGTCCATGTTCTCTGGCCCCAGCTCCATCTCTTCCATGAGCATGCCCTCCAGCATGGGCCACTCGGCGGTGCCCGGCATGCCCAACTCTAGTCTTAACAACATCAACAACCTTAATAACATCAGCAGCTCCTCCCTCAACTCCGCCATGTCTTCTACTGCTTGTCCCTATGGCCCCCCCGGCTCCCCATACACGGTATACAGGGACACTTGTAACTCGAGTTTGGCCAGCCTGAGACTGAAATCCAAGCAGCACTCCACCTTTGGCTACAGTAGCCTGCAGAGCCCGGCCTCCAGCCTCAATGCCTGCCAGTATAACAGTTGATAGACTCCCCAGCTGTGTGCCAACCCTGTGGACTCTCACAATGGACCAGACAATACTTTTTGTGCAAGACACCGAATCTAAGAACACATGGATGAGTTGCAATTTTTCTCTGGATTATGCGGGTTGTATGTGTTTACTTGAACTTGCACAGAAGTTCTCTGTAGCCACTCTCCCGGGGAGAGACTGGAGACAACACACATTTATATGGAACACGTTGGTGGCAGTAGTGGCCCCTCTGGTGGCGGTACCCACGGAGATTGCGCATCGCCTACCACTGACACCACAGGAATCTGCAGCCTTGGAATCTATAGGGAGAGGAAAAACAATGAATAAAGGGGTTTGAACAGAAAAAAAACACACAAGGGTTAACCACTTAAAAAGGTTATATGTATATATAAATATATAAGCCGCTACATTGTGTCTGATGCTTGTGCGGCGGTTCAATTTGGTTTCACAACAAATGCATGATTCTCAGTGTTTGTTCAGCTACAAGGAAGATCCGATTGTTTCCAAATACAACGTTCTTCGTTCTAGAATCCCCTACAGATCCACTCTGGAACCATTCGATCCATCTCCACGGCTCTTCTACGGTTATTTCATACCCCCCCCCCCCCCCTCCAAATGATCCTGGCAATTGTATGTATGCTATGCTTATAGATCAATCGATCGTCATTATTTATCTGCAATTTATAGCTCCCTATATGTATCCTAAATATGCTATGTACAAATAATAAATCATTCAAACCTTCTTGTGACTCCTGACAGTGCATCAATAAACCACCTGGAACCCGTAAGAATAACTCGAGTTGTTTTCCAATTTCTAGAAAACGTTTGAATGGGAAAACATATTTTCAAAGAAATAATCTAAAGTTTAGATTATTTAAGGATGGTTTAAAAAAAAAAACAAACTAAATAAATTATTTTTTAATATTAAAACGCATACAAAACGCATATGAAGTTTAATTGCAGGCGTATTTGTGACTTGTCAGTACGAAGGGATCTATATTAAGTGCACAAACTTTTACCCCCATCTTTCCCCTCTGTGTATTGTACACCTGTGGTAAAGGTTATGTGGATGTGTGGATGTTAAATAATGCTCTTGTGGATAAGAATGCAGTGTATTGTTTTTTTTATAAGTTATGTTTTTTGTTTTGTGATTTTTTTTTCAAAAATTAAGAGCATGGGAATAAAACGAATCTAAGAAATAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd0 FL                            IMAGE:6979090                                                                                                                                                                                                                                                                                                                                                       GGCTAGCAAGTCCAGCACTCTCATACATGCATGCCTGGGAACCTGCAGCCACCGATCTGCTGAAAGGAAGACGAAATAAAAAAGGGGAAAACTTCTGTAAAGGCGTTTCCATGGGCCGCCACCCTGAGAAGGGCAGAAAGTGGATTTGATTTGGTTGGTGTAGGATTTTGTGGAATACGCGTTTCATGAGCAGAGTGATTTACCATGGATTCCTTTAAAGGAGCTATGAATTTGGAAAGATTGCCTGAGAGTTTAAGACCCCAGCCTTCCCACGACATGGCCACTAGTTTCCATTTGCAGCGATCATCTGAAGCCAGGGATCCCATGGACAATTCAGCCAGTGAGTCTTCTGATACTGAAATCGCAGAGAAAGAACGAAGTGGGGAGCCAAAGGGAGAGGACGGCAATGGGGATGATCCCACAAAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAACCAGCAGATGGACCTGTGCAAGAATGGCTACGTGCCCCAGTTCAGCGGCCTGATGCAGCCCTACGATGAGATGTACGCTGGCTACCCGTACACAACTGGGCCACCNAAAGCCTCACCCTGCCCCCCTGTCCACAAGAGCTTCACCTCTTCACTTCATGAGTCGCTGTCCTCCATCCATGTCCCTGGCCAGCTCATCCTTTCTGACTAGCTCAGATGGGCCTCGGGGGCCGGATGCAATT
  5   1   2      seed HeRe 5g3  out                    EC2CAA12CF08.g1                                                                                                                                                                                                                                                                                                                                                                   GAGCACTCTCATACATGCATGCCTGGGAACCTGCAGCCACCGATCTGCTGAAAGGAAGACGAAATAAAAAAGGGGAAAACTTCTGTAAAGGCGTTTCCATGGGCCGCCACCCTGAGAAGGGCAGAAAGTGGATTTGATTTGGTTGGTGTAGGATTTTGTGGAATACGCGTTTCATGAGCAGAGTGATTTACCATGGATTCCTTTAAAGGAGCTATGAATTTGGAAAGATTGCCTGAGAGTTTAAGACCCCAGCCTTCCCACGACATGGCCACTAGTTTCCATTTGCAGCGATCATCTGAAGCCAGGGATCCCATGGACAATTCAGCCAGTGAGTCTTCTGATACTGAAATCGCAGAGAAAGAACGAAGTGGGGAGCCAAAGGGAGAGGACGGCAATGGGGATGATCCCACAAAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAA
  5   1   2       bld TbA  5g3  out                  TTbA052m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                  CCTGCGCCCCGATCTGCTGAAAGGAATACGAAATAAAAAAGGGGAAAACTTCTGTAAAGACGTTTCCATGGGCCGCCACCCTGAGAAGGGCAGAAAGTGGATTTGATTTGGTTGGTGTAGGATTTTGTGGAATACGCGTTTCATGAGCAGAGTGATTTACCATGGATTCCTTTAAAGGAGCTATGAATTTGGAAAGATTGCCTGAGAGTTTAAGACCCCAGCCTTCCCACGACATGGCCACTAGTTTCCATTTGCAGCGATCATCTGAAGCCAGGGATCCCATGGACAATTCAGCCAGTGAGTCTTCTGATACTGAAATCGCAGAGAAAGAACGAAGTGGGGAGCCAAAGGGAGAGGACGGCAATGGGGATGATCCCACAAAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAACCAGCAGATGGACCTGTGCAAGAATGGCTACGTGCCCCAGTTCAGCGGCCTGATGCAGCCCTACGATGAGATGTACGCTGGCTACCCGTACAACAACTGGGCCACCAAAAGCCTCACCCCTGCCCCCCTGTCCACCAAGAGCTTCACCTTCTTCAACTCCATGAGTCCGCTGTCCTCCCAGTCCATGTTCTCTGGCCCCAGCTCCATCTCTTCCATGAGCATGCCCTCCAGCATGGGCCACTCGGCGGTGCCCGGCATGCCCAACTCTAGTCTTAACAACATNCACAACCCCTTATACATCAGCAGCTCCTCCCCTCACTCCGCCATGTCTTCTACTGC
  5   1   2       bld HeRe      out                    EC2CAA10BA07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTAGTCTCTGTATTAGTACAGAAATCAATATGTATATACAGATAAATCTATAAGTATTATAGGAAGTGTGTGCCTGCCTCCGGAGCACAACAGCCAGTTCCCAAGCTCAGGTACCGAGGTGCCACTTAGGCCCAATGGGACCCGCCTAATAATTATCCTGTAATCTCGATGTGTTTGACAGAGAAAGAACGAAGTGGGGAGCCAAAGGGAGAGGACGGCAATGGGGATGATCCCACAAAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTAAGTGCCGGGCACAGGAATGAATAAGAACACCCACTATATGGAAGTGTCAAACGAAGGTGGCTAGTAGGGCCCCTGGAAATATGCACCCAGGCCACTTCATTCTGCAAATGGGGATAAGTCTAATCTGTGATGGTTTTGCCTATGGAGCTTTTTGGCTGTATGTGCTGAAATATGAATATGTTAAGATAAGGTTGGGGGGGTCAAGTAATAGACGTGATCATTTTTTGCTATATGTGTTCACCTCTAGTATCTATAGTATCCAGTTAGCAATTTGTTTTAATCAGTTTAGTGCAGTCTGGGGTACTGCGCCTTTT
  5   1   2       bld Tad5      out                        XZT14723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAACCAGCAGATGGACCTGTGCAAGAATGGCTACGTGCCCCAGTTCAGCGGCCTGATGCAGCCCTACGATGAGATGTACGCTGGCTACCCGTACAACAACTGGGCCACCAAAAGCCTCACCCCTGCCCCCCTGTCCACCAAGAGCTTCACCTTCTTCAACTCCATGAGTCCGCTGTCCTCCCAGTCCATGTTCTCTGGCCCCAGCTCCATCTCTTCCATGAGCATGCCCTCCAGCATGGGCCACTCGGCGGTGCCCGGCATGCCCAACTCTAGTCTTAACAACATCAACAACCTTAATAACATCAGCAGCTCCTCCCTCAACTCCGCCATGTCTTCTACTGCTTGTCCCTATGGCCCCCCCGGCTCCCCATACACGGTATACAGGGACACTTGTAACTCGAGTTTGGCCAGCCTGAGACTGAAATCCAAGCAGCACTCCACCTTTGGCTACAGTAGCCTGCAGAGCCCGGCCTCCAGCCTCAATGCCTGCCAGTATAACAGTTGATAGACTCCCCAGCTGTGTGCCAACCCTGTGGACTCTCACAATGGACCAGACAATACTTTTTGTGCAAGACACCGAATCTAAGAACACATGGATGAGTTGCAATTTTTCTCTGGATTATGCGGGTTGTATGTGTTTACTTTGACTTGCACA
  5   1   2       bld Tad5      out                        XZT20849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAACCAGCAGATGGACCTGTGCAAGAATGGCTACGTGCCCCAGTTCAGCGGCCTGATGCAGCCCTACGATGAGATGTACGCTGGCTACCCGTACAACAACTGGGCCACCAAAAGCCTCACCCCTGCCCCCCTGTCCACCAAGAGCTTCACCTTCTTCAACTCCATGAGTCCGCTGTCCTCCCAGTCCATGTTCTCTGGCCCCAGCTCCATCTCTTCCATGAGCATGCCCTCCAGCATGGGCCACTCGGCGGTGCCCGGCATGCCCAACTCTAGTCTTAACAACATCAACAACCTTAATAACATCAGCAGCTCCTCCCTCAACTCCGCCATGTCTTCTACTGCTTGTCCCTATGGCCCCCCCGGCTCCCCATACACGGTATACAGGGACACTTGTAACTCGAGTTTGGCCAGCCTGAGACTGAAATCCAAGCAGCACTCCACCTTTGGCTACAGTAGCCTGCAGAGCCCGGCCTCCAGCCTCAATGCCTGCCAGTATAACAGTTGATAGACTCCCCAGCTGTGTGCCAACCCTGTGGACTCTCACAATGGACCAGACAATACTTTTTGTGCAAGACACCGAATCTAAGAACACATGGATGAGTTTGCATTTTTCTCTGGATTATGCGGGTTGTATGTGTTTACTTTGACTTGCACAGAAGTTCTCTGT
  5   1   2       bld Tad5      out                        XZT33444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACAACCTTAATAACATCAGCAGCTCCTCCCTCAACTCCGCCATGTCTTCTACTGCTTGTCCCTATGGCCCCCCCGGCTCCCCATACACGGTATACAGGGACACTTGTAACTCGAGTTTGGCCAGCCTGAGACTGAAATCCAAGCAGCACTCCACCTTTGGCTACAGTAGCCTGCAGAGCCCGGCCTCCAGCCTCAATGCCTGCCAGTATAACAGTTGATAGACTCCCCAGCTGTGTGCCAACCCTGTGGACTCTCACAATGGACCAGACAATACTTTTTGTGCAAGACACCGAATCTAAGAACACATGGATGAGTTGCAATTTTTCTCTGGATTATGCGGGTTGTATGTGTTTACTTGAACTTGCACAGAAGTTCTCTGTAGCCACTCTCCCGGGGAGAGACTGGAGACAACACACATTTATATGGAACACGTTGGTGGCAGTAGTGGCCCCTCTGGTGGCGGTACCCACGGAGATTGCGCATCGCCTACCACTGACACCACAGGAATCTGCAGCCTTGGAATCTATAGGGAGAGGAAAAACAATGAATAAAGGGGTTTGAACAGAAAAAAAACACACAAGGGTTAACCACTTAAAAAGGTTATATGTATATATAAATATATAAGCCGCTACATTGTGTCTGATGCTTGTGCGGCGGTTCAATTTGGTTTCACAACAAATGCATGATTCTCAGTGTTTGTTCAGCTACAAGGAAGATCCGATTGTTTCCAAATACAACGTTCTTCGTTCTAGAATCCCCTACAGATCCACTCTGGAACCATTCGATCCATCTCCACGGCTCTTCTACGGTTATTTCATACCCCCCCCCCCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)