Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAR2267.3                            9 END     2          50       22                (no blast hit)
     2   2.0    0Xt7.1-TEgg007p20.5                          2 END     1          25       50                mucolipin 3 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012091534 Xt7.1-CAAM5557.5 - 4 ESTs
                                                                       .-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAM5557.5                                                                                                                                                                                                          TTGCAACTAGGTCTGACAGTAGGACAATGTGGCAGGTCACGTGACAGCAGTGCTGATGGTAGAGATGCGCCAGCATTCAGGTCTGAGAGCAGAAAGAAAAGCTGGCCAAAACAAAGGACATTCTCTTTGCTGCTTCGCTAGCTGAGACGCTGCTATAGTATAGCAGACATGGAAAACCCAGAGCTAATAAAGACATGCAACTCTTTGGATGAACATGATGGTCCCTACTGCTGCAAGCAGTGCCCTATGACTGATGAGCTACTTATGGAAGACCAGCTACGAAGGAAACTTAAATTCTTTTTCATGAACCCATGTGAGAAGTTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCAATGGTGACAATCCAATTAGTTTTATTTGGACTCAGTAATGAAATGGTAGTCACCTTTAAAGAGGAGAACACTGTAGCTTTTAAGCATCTGTTTTTGAAAGGATATAAGGATGGACATGATGACACATATGCTATCTACAGTCAAGAAGATGTTCATGCTCATATAAACTTTACAATTAAAAGGTACCTAGAGCTACAAAACATATCTGTTGGAAATCATGCATATGAAAGTAATGGTAAAGGTCAAACTGGAATGTCATTATGTCAACATTACTATAAACAAGGGAGTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATAGATACTGAATGTTTCCATATTGATCCATCAACTCTGTGTTCTAATGACACACCTGCAGAATACTACTGGTCTAATATGACACTAGACTTCTATAGACTTGTTTCAGTTGAAATTATGTTT
                                                  Xt7.1-CHK-1008245826                                                                                                                                                                                                                CTAGGTCTGACAGTAGGACAATGTGGCAGGTCACGTGACAGCAGTGCTGATGGTAGAGATGCGCCAGCATTCAGGTCTGAGAGCAGAAAGAAAAGCTGGCCAAAACAAAGGACATTCTCTTTGCTGCTTCGCTAGCTGAGACGCTGCTATAGTATAGCAGACATGGAAAACCCAGAGCTAATAAAGACATGCAACTCTTTGGATGAACATGATGGTCCCTACTGCTGCAAGCAGTGCCCTATGACTGATGAGCTACTTATGGAAGACCAGCTACGAAGGAAACTTAAATTCTTTTTCATGAACCCATGTGAGAAGTTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCAATGGTGACAATCCAATTAGTTTTATTTGGACTCAGTAATGAAATGGTAGTCACCTTTAAAGAGGAGAACACTGTAGCTTTTAAGCATCTGTTTTTGAAAGGATATAAGGATGGACATGATGACACATATGCTATCTACAGTCAAGAAGATGTTCATGCTCATATAAACTTTACAATTAAAAGGTACCTAGAGCTACAAAACATATCTGTTGGAAATCATGCATATGAAAGTAATGGTAAAGGTCAAACTGGAATGTCATTATGTCAACATTACTATAAACAAGGGAGTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATAGATACTGAATGTTTCCATATTGATCCATCAACTCTGTGTTCTAATGACACACCTGCAGAATACTACTGGTCTAATATGACACTAGACTTCTATAGACTTGTTTCAGTTGAAATT
                                                      consensus depths                                                                                                                                                                                                               1     1     1     1     1     1     1     1     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     4     2     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1
                                               BLH ATG     168     526                                                                                                                                                                                                          
                                               BLH MIN     153      76                                                                                                                                                                                                          
                                               BLH OVR     168     196                                                                                                                                                                                                          
                                               ORF LNG     168       8                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 2e-019     NP_001022722.1 Coelomocyte UPtake defective family member (cup-5) [Caenorhabditis elegans] ----------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 8e-025     NP_649145.1 CG8743-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 3e-026     XP_789832.2 PREDICTED: similar to mucolipin-3 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dr ---- 8e-053     NP_998545.1 zgc:63619 [Danio rerio] --------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Gg ---- 2e-074     XP_426647.2 PREDICTED: similar to Mucolipin 3 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 2e-075     NP_598921.1 mucolipin 3; varitint-waddler; 6720490O21Rik [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 8e-078     NP_060768.8 mucolipin 3 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 7e-115     AAH73192.1 MGC80434 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 7e-115     NP_001085683.1 MGC80434 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 5e-132     CAJ83717.1 mucolipin 3 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAM5557.5                                                                                                                                                                                                                                                                                                                                                    TAG---------------------------ATG---------------------------------------------------------------------------ATG---------------ATG------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  0   1   1           Egg  FL                     TEgg015j11.FL-Sanger                                                                                                                                                                                                          TTGCAACTAGGTCTGACAGTAGGACAATGTGGCAGGTCACGTGACAGCAGTGCTGATGGTAGAGATGCGCCAGCATTCAGGTCTGAGAGCAGAAAGAAAAGCTGGCCAAAACAAAGGACATTCTCTTTGCTGCTTCGCTAGCTGAGACGCTGCTATAGTATAGCAGACATGGAAAACCCAGAGCTAATAAAGACATGCAACTCTTTGGATGAACATGATGGTCCCTACTGCTGCAAGCAGTGCCCTATGACTGATGAGCTACTTATGGAAGACCAGCTACGAAGGAAACTTAAATTCTTTTTCATGAACCCATGTGAGAAGTTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCAATGGTGACAATCCAATTAGTTTTATTTGGACTCAGTAATGAAATGGTAGTCACCTTTAAAGAGGAGAACACTGTAGCTTTTAAGCATCTGTTTTTGAAAGGATATAAGGATGGACATGATGACACATATGCTATCTACAGTCAAGAAGATGTTCATGCTCATATAAACTTTACAATTAAAAGGTACCTAGAGCTACAAAACATATCTGTTGGAAATCATGCATATGAAAGTAATGGTAAAGGTCAAACTGGAATGTCATTATGTCAACATTACTATAAACAAGGGAGTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATAGATACTGAATGTTTCCATATTGATCCATCAACTCTGTGTTCTAATGACACACCTGCAGAATACTACTGGTCTAATATGACACTAGACTTCTATAGACTTGTTTCAGTTGAAATTATGTTTAAGCTTAAAGCAATTAATCTTCAAACCATTCGTCATCATGAACTTCCAGACTGCTATGACTTCATGGTTATAATAACATTTGATAATAAGGCACACAGTGGAAGGATAAAAATCAGCTTAGATAATGATGTTGGAATCCAGGAATGCAAAGACTGGCATGTGTCTGGATCTATTCAAAAAAATACTCATTACATGATGATTTTTGATGCTGCTGTTATTTTGGTCTGCTTATCTTCCATAACACTCTGCATTCGCTCCGTGGTTAAAGGAATTCACCTACAAAAAGAATATGTAAACTTTTTCCAGCATCGTTTTGCAAGGACTGTGTCCTCAGCTGATCGCATGGAATTTGTCAATGGCTGGTACATTATGATAATCATCAGTGATGTTTTGTCAATTATTGGCTCAATCTTGAAGATGGAGATCCAAGCAAAGAGCCTCACCAGTTATGATGTCTGCAGTATTCTCTTGGGAACATCCACCTTATTAGTGTGGCTTGGAGTTATTCGCTACTTGGGATTTTTTAAGAAATACAATCTTCTGATCCTGACACTTAGGGCAGCCTTACCTAATGTGATACGATTCTGCTGTTGTGCTGCTATGATCTACCTGGGCTACTGCTTCTGTGGCTGGATTGTTCTGGGGCCTTACCATGTAAAGTTCAGGTCCCTGAACATGGTTTCAGAGTGCCTGTTCTCCCTTATTAATGGAGACGATATGTTTACAACGTTTTCAATCATGCAGGAGAAGAGCTACTTGGTTTGGCTGTTTAGTCGCATTTATTTGTATTCCTTTATAAGTCTCTTCATATACATGGTTCTGAGTCTCTTCATTGCACTTATTACTGACACATACGATACAATCAAGAATTACCAGATCGATGGCTTTCCAGAATCAGAACTTCACACATTTGTATCCGAGTGCAAAGATTTGCCAACCTCTGGTCGATATAGGGAACAAGACGAGACCTCCTGTTTGTCTATGCTGTGTTGTAATCGGTAAAAAAGAATCCCAGAAGAAGCACTTTATCCATGGCCTTTAAAAATCTGCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  FL   ?                    TEgg015j11.p1kSP6                                                                                                                                                                                                          TTGCAACTAGGTCTGACAGTAGGACAATGTGGCAGGTCACGTGACAGCAGTGCTGATGGTAGAGATGCGCCAGCATTCAGGTCTGAGAGCAGAAAGAAAAGCTGGCCAAAACAAAGGACATTCTCTTTGCTGCTTCGCTAGCTGAGACGCTGCTATAGTATAGCAGACATGGAAAACCCAGAGCTAATAAAGACATGCAACTCTTTGGATGAACATGATGGTCCCTACTGCTGCAAGCAGTGCCCTATGACTGATGAGCTACTTATGGAAGACCAGCTACGAAGGAAACTTAAATTCTTTTTCATGAACCCATGTGAGAAGTTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCAATGGTGACAATCCAATTAGTTTTATTTGGACTCAGTAATGAAATGGTAGTCACCTTTAAAGAGGAGAACACTGTAGCTTTTAAGCATCTGTTTTTGAAAGGATATAAGGATGGACATGATGACACATATGCTATCTACAGTCAAGAAGATGTTCATGCTCATATAAACTTTACAATTAAAAGGTACCTAGAGCTACAAAACATATCTGTTGGAAATCATGCATATGAAAGTAATGGTAAAGGTCAAACTGGAATGTCATTATGTCAACATTACTATA
  5   1   2       bld Egg  5g                        TEgg015n24.p1kSP6                                                                                                                                                                                                                                                         CCGGGGTGCTGATGGTAGAGATGCGCCAGCATTCAGGTCTGAGAGCAGAAAGAAAAGCTGGCCAAAACAAAGGACATTCTCTTTGCTGCTTCGCTAGCTGAGACGCTGCTATAGCATAGACATGGAAAACCCAGAGCTAATAAAGACATGCAACTCTTTGGATGAACATGATGGTCCCTACTGCTGCAAGCAGTGCCCTATGACTGATGAGCTACTTATGGAAGACCAGCTACGAAGGAAACTTAAATTCTTTTTCATGAACCCATGTGAGAAGTTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCAATGGTGACAATCCAATTAGTTTTATTTGGACTCAGTAATGAAATGGTAGTCACCTTTAAAGAGGAGAACACTGTAGCTTTTAAGCATCTGTTTTTGAAAGGATATAAGGATGGACATGATGACACATATGCTATCTACAGTCAAGAAGATGTTCATGCTCATATAAACTTTACAATTAAAAGGTACCTAGAGCTACAAAACATATCTGTTGGAAATCATGCATATGAAAGTAATGGTAAAGGTCAAACTGGAATGTCATTATGTCAACATTACTATAAACAAGGGAGTATCTTTCCTGGAAATGAAACATTTGAAATTG
  5   1   2   14  bld Te3  5g3  out                        CAAM5557.5p ............................................................................................................................................................................................................................................................................CGCCAGCATTCAGGTCTGAGAGCAGAAAGAAAAGCTGGCCAAAACAAAGGACATTCTCTTTGCTGCTTCGCTAGCTGAGACGCTGCTATAGTATAGCAGACATGGAAAACCCAGAGCTAATAAAGACATGCAACTCTTTGGATGAACATGATGGTCCCTACTGCTGCAAGCAGTGCCCTATGACTGATGAGCTACTTATGGAAGACCAGCTACGAAGGAAACTTAAATTCTTTTTCATGAACCCATGTGAGAAGTTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCAATGGTGACAATCCAATTAGTTTTATTTGGACTCAGTAATGAAATGGTAGTCACCTTTAAAGAGGAGAACACTGTAGCTTTTAAGCATCTGTTTTTGAAAGGATATAAGGATGGACATGATGACACATATGCTATCTACAGTCAAGAAGATGTTCATGCTCATATAAACTTTACAATTAAAAGGTACCTAGAGCTACAAAACATATCTGTTGGAAATCATGCATATGAAAGTAATGGTAAAGGTCAAACTGGAATGTCATTATGTCAACATTACTATAAACAAGGGAGTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATAGATACTGAATGTTTCCATATTGATCCATCAACTCTGTGTTCTAATGACACACCTGCAGAATACTACTGGTCTAATATGACACTAGACTTCTATAGACTTGTTTCAGTTGAAATTATGTTTAAGC
  5   1   2      seed TbA  5g3  out                  TTbA055o05.p1kSP6                                                                                                                                                                                                                                                                                                                                     TTGAGCTAGCAAGTGTGCAGCAGACTGGCCAGATATATAGCACACATGGAAAACCCAGAGCTAATAAAGACATGCAACTCTTTGGATGAACATGATGGTCCCTACTGCTGCAAGCAGTGCCCTATGACTGATGAGCTACTTATGGAAGACCAGCTACGAAGGAAACTTAAATTCTTTTTCATGAACCCATGTGAGAAGTTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCAATGGTGACAATCCAATTAGTTTTATTTGGACTCAGTAATGAAATGGTAGTCACCTTTAAAGAGGAGAACACTGTAGCTTTTAAGCATCTGTTTTTGAAAGGATATAAGGATGGACATGATGACACATATGCTATCTACAGTCAAGAAGATGTTCATGCTCATATAAACTTTACAATTAAAAGGTACCTAGAGCTACAAAACATATCTGTTGGAAATCATGCATATGAAAGTAATGGTAAAGGTCAAACTGGAATGTCATTATGTCAACATTACTATAAACAAGGGAGTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATAGATACTGAATGTTTCCATATTGATCCATCAACTCTGTGTTCTAATGACACACCTGCAGAATACTACTGGTCTAATATGACACTAGACTTCTATAGACTTGTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)