Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ24446.5.5                        33 END     2          66        6                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012091551 Xt7.1-CAAJ11980.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ11980.5 TCCGGGAAGCTGAGACTCCTCGGCTGCATGACTGACACATTGCGCACAGGCGCCTGAGCATCAGCCCCTCATTGCTGCCCAATTTCCTTCATTTTTGCCTCTCGCATCTGCTTCATTTTGATACTGGATCCGCGCCCTCGTCAGCAGAAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTTATTCGACTTGAATCGGTGCTTTCAAATTCTTTTTCTTCCAGCTCAGCTGAGAATAATGTTGTTAATGGCATAAATGGAGGTGTCGTCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCTGGGGCCTTGGAGGAATATGTCAAGAATAGTAAAGTTATTGGTGGGGATGTAGAGACACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAACATTTTTGGTTTTTGCTTCACAACACCAGCAACCCCCACAGGCAGAAGAATGCTTAATCCTAAAGCCGATTTCTGAAAAAATCCTTGAAATACAGTCATTCAGAGAAAAAAATCGTGGAAGTCAACTATTCAACCACCTTTCTGGCATCAGTGAAAGTATACCAGCGCTTGGCTGGATTGCCATGTCCCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCCACGCCATGTGGATTGGGTCAAATCATACTTGAATATTTGGAGCGAGCTGCAAGCATACATTAAGGAATATCACACTACAGGAGTTTCCTGGGGGAATGCTATATGTTCAGTTCCATCAACTGCCAAAGGAGTCGCTCTACTGCAAAAATCATCTGAAGTCAAGTTGTCCCACCC
                                                  Xt7.1-CHK-1008248920       AAGCTGAGACTCCTCGGCTGCATGACTGACACATTGCGCACAGGCGCCTGAGCATCAGCCCCTCATTGCTGCCCAATTTCCTTCATTTTTGCCTCTCGCATCTGCTTCATTTTGATACTGGATCCGCGCCCTCGTCAGCAGAAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTTATTCGACTTGAATCGGTGCTTTCAAATTCTTTTTCTTCCAGCTCAGCTGAGAATAATGTTGTTAATGGCATAAATGGAGGTGTCGTCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCTGGGGCCTTGGAGGAATATGTCAAGAATAGTAAAGTTATTGGTGGGGATGTAGAGACACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAACATTTTTGGTTTTTGCTTCACAACACCAGCAACCCCCACAGGCAGAAGAATGCTTAATCCTAAAGCCGATTTCTGAAAAAATCCTTGAAATACAGTCATTCAGAGAAAAAAATCGTGGAAGTCAACTATTCAACCACCTTTCTGGCATCAGTGAAAGTATACCAGCGCTTGGCTGGATTGCCATGTCCCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCCACGCCATGTGGATTGGGTCAAATCATACTTGAATATTTGGAGCGAGCTGCAAGCATACATTAAGGAATATCACACTACAGGAGTTTCCTGGGGGAATGCTATATGTTCAGTTCCATCAACTGCCAAAGGAGTCGCTCTACTGCAAAAATCATCTGAAGTCAAGTTGTCCCACCCCTCCCC
                                                      consensus depths      1     1     1     1     1     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     163     441 
                                               BLH MIN     163      80 
                                               BLH MPR     118      80 
                                               BLH OVR     163     754 
                                               CDS MIN     163      80 
                                               ORF LNG     163      37 
                                                                                                                                                                                                               PROTEIN --- Sc ---- 6e-031     NP_014261.1 N-terminal domain appears to be involved in cellular responsiveness to RAS.;Srv2p [Saccharomyces cerevisiae] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                             PREDICTED - Sp ---- 4e-031     XP_001200649.1 PREDICTED: similar to adenylyl cyclase-associated protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PROTEIN === Ce ==== 4e-034     NP_510713.1 adenylyl Cyclase ASsociated protein Homolog (53.0 kD) (cas-1) [Caenorhabditiselegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 2e-046     NP_001033869.1 capulet CG33979-PA, isoform A [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PREDICTED = Xt ==== 2e-064     AAH67981.1 Hypothetical protein MGC69395 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 2e-065     NP_957130.1 hypothetical protein MGC73317 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PROTEIN === Hs ==== 2e-078     NP_006357.1 adenylyl cyclase-associated protein 2 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PROTEIN === Mm ==== 5e-079     NP_080332.1 CAP, adenylate cyclase-associated protein, 2 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PREDICTED = Gg ==== 8e-083     XP_418936.2 PREDICTED: hypothetical protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PROTEIN === Xl ==== 9e-116     AAQ75549.1 cyclase associated protein 2 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PROTEIN === ?? ==== 9e-116     NP_001085243.1 cyclase associated protein 2 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ11980.5           TGA---------------TGA---------------------------------------------------------------------------------------TGA------------------------------------------ATG------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG
                                                                   ORF                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2   14  bld Brn2 5g3  out                       CAAJ14097.5p TCCGGGAAGCTGAGACTCCTCGGCTGCATGACTGACACATTGCGCACAGGCGCCTGAGCATCAGCCCCTCATTGCTGCCCAATTTCCTTCATTTTTGCCTCTCGCATCTGCTTCATTTTGATACTGGATCCGCGCCCTCGTCAGCAGAAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTTATTCGACTTGAATCGGTGCTTTCAAATTCTTTTTCTTCCAGCTCAGCTGAGAATAATGTTGTTAATGGCATAAATGGAGGTGTCGTCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCTGGGGCCTTGGAGGAATATGTCAAGAATAGTAAAGTTATTGGTGGGGATGTAGAGACACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAACATTTTTGGTTTTTGCTTCACAACACCAGCAACCCCCACAGGCAGAAGAATGCTTAATCCTAAAGCCGATTTCTGAAAAAATCCTTGAAATACAGTCATTCAGAGAAAAAAATCGTGGAAGTCAACTATTCAACCACCTTTCTGGCATCAGTGAAAGTATACCAGCGCTTGGCTGGATTGCCATGTCCCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCCACGCCATGTGGATTGGGTCAAATCATACTTGAATATTTGGAGCGAGCTGCAAGCATACATTAAGGAATATCACACTACAGGAG
  5   1   2   24 seed Brn2 5g                             CAAJ11980.5p ................................TGACACATTGCGCACAGGCGCCTGAGCATCAGCCCCTCATTGCTGCCCAATTTCCTTCATTTTTGCCTCTCGCATCTGCTTCATTTTGATACTGGATCCGCGCCCTCGTCAGCAGAAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTTATTCGACTTGAATCGGTGCTTTCAAATTCTTTTTCTTCCAGCTCAGCTGAGAATAATGTTGTTAATGGCATAAATGGAGGTGTCGTCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCTGGGGCCTTGGAGGAATATGTCAAGAATAGTAAAGTTATTGGTGGGGATGTAGAGACACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAACATTTTTGGTTTTTGCTTCACAACACCAGCAACCCCCACAGGCAGAAGAATGCTTAATCCTAAAGCCGATTTCTGAAAAAATCCTTGAAATACAGTCATTCAGAGAAAAAAATCGTGGAAGTCAACTATTCAACCACCTTTCTGGCATCAGTGAAAGTATACCAGCGCTTGGCTGGATTGCCATGTCCCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCCACGCCATGTGGATTGGGTCAAATCATACTTGAATATTTGGAGCGAGCTGCAAGCATACATTAAGGAATATCACACTACAGGAGTTTCCTGGGGGAATGCTATATGTTCAGTTCCATCAACTGCCAAAGGAGTCGCTCTACTGCAAAAATCATCTGAAGTCAAGTTGTCCCACCCCTCCCCCCTC
  5   1   2   14  bld Brn2 5g3  out                       CAAJ19939.5p ...................................CACATTGCGCACAGGCGCCTGAGCATCAGCCCCTCATTGCTGCCCAATTTCCTTCATTTTTGCCTCTCGCATCTGCTTCATTTTGATACTGGATCCGCGCCCTCGTCAGCAGAAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTTATTCGACTTGAATCGGTGCTTTCAAATTCTTTTTCTTCCAGCTCAGCTGAGAATAATGTTGTTAATGGCATAAATGGAGGTGTCGTCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCTGGGGCCTTGGAGGAATATGTCAAGAATAGTAAAGTTATTGGTGGGGATGTAGAGACACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAACATTTTTGGTTTTTGCTTCACAACACCAGCAACCCCCACAGGCAGAAGAATGCTTAATCCTAAAGCCGATTTCTGAAAAAATCCTTGAAATACAGTCATTCAGAGAAAAAAATCGTGGAAGTCAACTATTCAACCACCTTTCTGGCATCAGTGAAAGTATACCAGCGCTTGGCTGGATTGCCATGTCCCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCCACGCCATGTGGATTGGGTCAAATCATACTTGAATATTTGGAGCGAGCTGCAAGCATACATTAAGGAATATCACACTACAGGAGTTTCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)