Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA027e22.3                          2 END     2          50      100                Hypothetical protein MGC76192 [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZT29412.3                            2 END     1          25       50                Hypothetical protein MGC76192 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 754.0    0Xt7.1-CABH5914.3                            8 PI      81        142     1026                acetylcholin receptor alpha subunit 1A [Xenopus laevis]

 This cluster: approximate FL confidence score = 93%

 1012091653 Xt7.1-CBXT634.5 - 4 ESTs
                                                                       .....-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CBXT634.5                                                                                                                              GTGAAACCCAGTAGGCAAGATCTGAGAGGAGAGGAAGCAAATGGATTACACGGCCTCTTGCCTTATTTTCTTCTTTATTGCAGCTGGGCCAGTATTCAGTAGCGACCATGAAACTCGTCTCATTGGGGATCTGTTTGCCAACTACAACAAAGTGGTTCGCCCCGTAGAAACGTATAAGGATCAAGTGGTGGTAACTGTTGGACTGCAGCTCATCCAACTCATCAACGTGGATGAAGTCAACCAAATTGTGTCAACAAATATCCGCCTAAAACAGCAATGGGTAGATGTTAACCTCAAATGGGACCCAGCAAAATACGGTGGCGTAAAGAAGCTTCGAATTCCTTCGAGTGAGGTTTGGTGCCCAGATTTGGTTCTTTATAACAATGCAGATGGTGACTTTGCCATTTCCAAGGACACTAAAATCCTTCTGGAACACACCGGAAAGATAACATGGACACCCCCAGCGATTTTCAAAAGCTACTGTGAAATTATAGTCACACACTTTCCATTTGACCAGCAGAACTGCAGCATGAAGTTTGGCACTTGGACTTATGATGGCACCTTAGTAGTTATAAACCCGGACAGGGACCGACCAGATCTGAGCAACTTCATGGCAAGTGGAGAATGGATGATGAAGGATTATCGCTGCTGGAAGCATTGGGTTTATTATACCTGTTGCCCAGATAAGCCATATCTGGATATTACCTACCACTTTGTCCTACAAAGGCTTCCCCTCTATTTCATTGTCAACGTCATCATTCCTTGTCTGCTCTTCTCTTTCCTCACTGGCTTAGTATTTTACCTGCCTACTGATTCAGGAGAGAAAATGACGCTAAGCATTTCTGTCTTACTGTCCCTGACTGTGTTCCTTCTGGTCATCGTCGAGCTGATCCCTTCAACATCGAGCGCTGTCCCTTTAATTGGGAAATACATGTTATTCACCATGGTCTTTGTCATCGCTTCTATCATTATCACAGTCATCGTCATCAACACCCATCACCGCTCCCCAAGCACTCACACCATGCCTCCGTGGGTGAGAAAGATTTTCATAGACACCATCCCAACATTTATGTCTTCTCTACNCATGAACGTCCTTCACAAGAA
                                                  Xt7.1-CHK-1008245286                                                                                                                                    CCCAGTAGGCAAGATCTGAGAGGAGAGGAAGCAAATGGATTACACGGCCTCTTGCCTTATTTTCTTCTTTATTGCAGCTGGGCCAGTATTCAGTAGCGACCATGAAACTCGTCTCATTGGGGATCTGTTTGCCAACTACAACAAAGTGGTTCGCCCCGTAGAAACGTATAAGGATCAAGTGGTGGTAACTGTTGGACTGCAGCTCATCCAACTCATCAACGTGGATGAAGTCAACCAAATTGTGTCAACAAATATCCGCCTAAAACAGCAATGGGTAGATGTTAACCTCAAATGGGACCCAGCAAAATACGGTGGCGTAAAGAAGCTTCGAATTCCTTCGAGTGAGGTTTGGTGCCCAGATTTGGTTCTTTATAACAATGCAGATGGTGACTTTGCCATTTCCAAGGACACTAAAATCCTTCTGGAACACACCGGAAAGATAACATGGACACCCCCAGCGATTTTCAAAAGCTACTGTGAAATTATAGTCACACACTTTCCATTTGACCAGCAGAACTGCAGCATGAAGTTTGGCACTTGGACTTATGATGGCACCTTAGTAGTTATAAACCCGGACAGGGACCGACCAGATCTGAGCAACTTCATGGCAAGTGGAGAATGGATGATGAAGGATTATCGCTGCTGGAAGCATTGGGTTTATTATACCTGTTGCCCAGATAAGCCATATCTGGATATTACCTACCACTTTGTCCTACAAAGGCTTCCCCTCTATTTCATTGTCAACGTCATCATTCCTTGTCTGCTCTTCTCTTTCCTCACTGGCTTAGTATTTTACCTGCCTACTGATTCAGGAGAGAAAATGACGCTAAGCATTTCTGTCTTACTGTCCCTGACTGTGTTCCTTCTGGTCATCGTCGAGCTGATCCCTTCAACATCGAGCGCTGTCCCTTTAATTGGGAAATACATGTTATTCACCATGGTCTTTGTCATCGCTTCTATCATTATCACAGTCATCGTCATCAACACCCATCACCGCTCCCCAAGCACTCACACCATGCCTCCGTGGGTGAGAAAGATTTTCATAGACACCATCCCAACATTTATGTCTTCTCTACNCATGAACGTCCTTCACAAGAAAAACAG
                                                      consensus depths                                                                                                                                   1     1     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      40     306                                                                                                                              
                                               BLH MIN      40     193                                                                                                                              
                                               BLH OVR      40     172                                                                                                                              
                                               ORF LNG      40      16                                                                                                                              
                                                                                                                                                                                                                                   PROTEIN --- Ce ==== 2e-095     NP_491533.2 UNCoordinated locomotion UNC-63, LEVamisole resistant LEV-7, nicotinicacetylcholine receptor alpha subunit (57.3 kD) (unc-63) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Dm ---= 2e-097     NP_524481.2 CG5610-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 4e-101     XP_786790.2 PREDICTED: similar to nicotinic acetylcholine receptor alpha2 subunit [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 2e-162     NP_000070.1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) precursor [Homosapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Mm ==== 2e-162     XP_990011.1 PREDICTED: similar to Acetylcholine receptor protein, alpha subunit precursor [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 3e-165     NP_571520.1 cholinergic receptor, nicotinic, alpha polypeptide 1; nicotinic acetylcholinereceptor alpha-1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Gg ---= 2e-174     NP_990147.1 alpha-1 subunit, nicotinic acetylcholine receptor [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Xt ==== 0          AAH64235.1 Hypothetical protein MGC76192 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAH73452.1 MGC80957 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          NP_001085869.1 MGC80957 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CBXT634.5                                                                                                                               TGA------------------TGA---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------ATG---------------------------------------------ATG------------ATG
                                                                   ORF                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   1           Tbd0 FL                     IMAGE:5335894.FL-MGC                                                                                                                                                           AGAGGAAGCAAATGGATTACACGGCCTCTTGCCTTATTTTCTTCTTTATTGCAGCTGGGCCAGTATTCAGTAGCGACCATGAAACTCGTCTCATTGGGGATCTGTTTGCCAACTACAACAAAGTGGTTCGCCCCGTAGAAACGTATAAGGATCAAGTGGTGGATGAAGTCAACCAAATTGTGTCAACAAATATCCGCCTAAAACAGCAATGGGTAGATGTTAACCTCAAATGGGACCCAGCAAAATACGGTGGCGTAAAGAAGCTTCGAATTCCTTCGAGTGAGGTTTGGTGCCCAGATTTGGTTCTTTATAACAATGCAGATGGTGACTTTGCCATTTCCAAGGACACTAAAATCCTTCTGGAACACACCGGAAAGATAACATGGACACCCCCAGCGATTTTCAAAAGCTACTGTGAAATTATAGTCACACACTTTCCATTTGACCAGCAGAACTGCAGCATGAAGTTTGGCACTTGGACTTATGATGGCACCTTAGTAGTTATAAACCCGGACAGGGACCGACCAGATCTGAGCAACTTCATGGCAAGTGGAGAATGGATGATGAAGGATTATCGCTGCTGGAAGCATTGGGTTTATTATACCTGTTGCCCAGATAAGCCATATCTGGATATTACCTACCACTTTGTCCTACAAAGGCTTCCCCTCTATTTCATTGTCAACGTCATCATTCCTTGTCTGCTCTTCTCTTTCCTCACTGGCTTAGTATTTTACCTGCCTACTGATTCAGGAGAGAAAATGACGCTAAGCATTTCTGTCTTACTGTCCCTGACTGTGTTCCTTCTGGTCATCGTCGAGCTGATCCCTTCAACATCGAGCGCTGTCCCTTTAATTGGGAAATACATGTTATTCACCATGGTCTTTGTCATCGCTTCTATCATTATCACAGTCATCGTCATCAACACCCATCACCGCTCCCCAAGCACTCACACCATGCCTCCGTGGGTGAGAAAGATTTTCATAGACACCATCCCAAACATTATGTTCTTCTCTACCATGAAACGTCCTTCACAAGAAAAACAGCCTCAGACAACATTTGCAGAAGAGATGGACATATCAGACATTTCAGGAAAGCTCGGCCCAGCCGCAGTGACTTATCAGTCCCCAGCTCTAAAGAACCCCGATGTAAAGAGTGCCATAGAGGGCATTAAATATATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCTGAAGAATGGAAGTTCGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTCTTCATGACAGTCTGCGTCATAGGAACCTTGGCTGTGTTTGCCGGACGCATCATCGAAATGAACATGCAGGACTGAACAAAGTGCTTGTTTTGATTTTTTAATGTCAAATTAGACAGGAGGACTAGTTTTATCGCCACTCTTGCATTCACTTTGAGCCTACAGTTTTGCCATCTCAACAATAGCAACTATGTACCATCCCAAGCTCATAACTTACTGTACCTTTAGGTACAAAGAAACATACAATATTGTTAGAATAATGACCCTGCTTTGTGCAACAACTTGGCATTTATCCCACATCTTTGCCTGATTGCTACTCAAGCTGAGCTGCCCATTAGCAAGGGCCACACAATCATATTGCTATAAGCACAGGTGAGCTTCAAGTCCTTGTTTGGGCATTCTAGTTCAGCAACAGCTGTTGGGCCACGGGCTGGGCATTCCTTATGTGAGTGCAGTTCCACAGAGATTAATGTTCAATACAGCATCATTGTGTTTTTTTTCTACTTTGATATTCTATAAGGATATAGCATAGAATAAATAAATATAATAGCTACAATAAATACAATATTGAAGAAAAAAAAAAAAAAAAA
  5   1   2   10 seed Tbd1 5g3  out                         CBXT634.b1 .............................................................................................................................GTGAAACCCAGTAGGCAAGATCTGAGAGGAGAGGAAGCAAATGGATTACACGGCCTCTTGCCTTATTTTCTTCTTTATTGCAGCTGGGCCAGTATTCAGTAGCGACCATGAAACTCGTCTCATTGGGGATCTGTTTGCCAACTACAACAAAGTGGTTCGCCCCGTAGAAACGTATAAGGATCAAGTGGTGGTAACTGTTGGACTGCAGCTCATCCAACTCATCAACGTGGATGAAGTCAACCAAATTGTGTCAACAAATATCCGCCTAAAACAGCAATGGGTAGATGTTAACCTCAAATGGGACCCAGCAAAATACGGTGGCGTAAAGAAGCTTCGAATTCCTTCGAGTGAGGTTTGGTGCCCAGATTTGGTTCTTTATAACAATGCAGATGGTGACTTTGCCATTTCCAAGGACACTAAAATCCTTCTGGAACACACCGGAAAGATAACATGGACACCCCCAGCGATTTTCAAAAGCTACTGTGAAATTATAGTCACACACTTTCCATTTGACCAGCAGAACTGCAGCATGAAGTTTGGCACTTGGACTTATGATGGCACCTTAGTAGTTATAAACCCGGACAGGGACCGACCAGATCTGAGCAACTTCATGGCAAGTGGAGAATGGATGATGAAGGATTATCGCTGCTGGAAGCATTGGGTTTATTATACCTGTTGCCCAGATAAGCCATATCTGGATATTACCTACCACTTTGTCCTACAAAGGCTTCCCCTCTATTTCATTGTCAACGTCATCATTCCTTGTCTGCTCTTCTCTTTCCTCAC
  5   1   2       bld TbA  5g3  out                  TTbA027e22.p1kSP6                                                                                                                               TGAAACCCAGTAGGCAAGATCTGAGAGGAGTGGAAGCAAATGGATTACACGGCCTCTTGCCTTATTTTCTTCTTTATCGCAGCTGGGCCAGTATTCAGTAGCGACCATGAAACTCGTCTCATTGGGGATCTGTTTGCCAACTACAACAAAGTGGTTCGCCCCGTAGAAACGTATAAGGATCAAGTGGTGGTAACTGTTGGACTGCAGCTCATCCAACTCATTAACGTGGATGAAGTCAACCAAATTGTGTCAACAAATATCCGCCTAAAACAGCAATGGGTAGATGTTAACCTCAAATGGGACCCAGCAAAATACGGTGGCGTAAAGAAGCTTCGAATTCCTTCGAGTGAGGTTTGGTGCCCAGATTTGGTTCTTTATAACAATGCAGATGGTGACTTTGCCATTTCCAAGGACACTAAAATCCTTCTGGAACACACCGGAAAGATAACATGGACACCCCCAGCGATTTTCAAAAGCTACTGTGAAATTATAGTCACACACTTTCCATTTGACCAGCAGAACTGCAGCATGAAGTTTGGCACTTGGACTTATGATGGCACCTTAGTAGTTATAAACCCGGACAGGGACAGACCAGATCTGAGCAACTTCATGGCAAGTGGAGAATGGATGATGAAGGACTATCGCTGCTGGAAGCATTGGGTTTATTATACCTGTTGCCCAGATAAGCCATATCTGGATATTACCTACCACTTTGTCCTACAAAGGCTTCCCCTCTATTTCATTGTCAACGTCATCATTCCTTGTCTGCTCTTCTCTTTCCTCACTGGCTTAGTATTTTACCTGCCTACTGATTCAGGAGAGAAAATGACGCTAAGCATTTCTGTCTTACTGTCCCTGACTGTGTTCCTTCTGGTCATCGTC
  5   1   2       bld Tbd0 FL   out                   IMAGE:5335894.y1                                                                                                                                                                                                   GAGGAAGCAAATGGATTACACGGCCTCTTGCCTTATTTTCTTCTTTATTGCAGCTGGGCCAGTATTCAGTAGCGACCATGAAACTCGTCTCATTGGGGATCTGTTTGCCAACTACAACAAAGTGGTTCGCCCCGTAGAAACGTATAAGGATCAAGTGGTGGATGAAGTCAACCAAATTGTGTCAACAAATATCCGCCTAAAACAGCAATGGGTAGATGTTAACCTCAAATGGGACCCAGCAAAATACGGTGGCGTAAAGAAGCTTCGAATTCCTTCGAGTGAGGTTTGGTGCCCAGATTTGGTTCTTTATAACAATGCAGATGGTGACTTTGCCATTTCCAAGGACACTAAAATCCTTCTGGAACACACCGGAAAGATAACATGGACACCCCCAGCGATTTTCAAAAGCTACTGTGAAATTATAGTCACACACTTTCCATTTGACCAGCAGAACTGCAGCATGAAGTTTGGCACTTGGACTTATGATGGCACCTTAGTAGTTATAAACCCGGACAGGGACCGACCAGATCTGAGCAACTTCATGGCAAGTGGAGAATGGATGATGAAGGATTATCGCTGCTGGAAGCATTGGGTTTATTATACCTGTTGCCCAGATAAGCCATATCTGGATATTACCTACCACTTTGTCC
  5   1   2       bld Tad5                                 XZT12158.5p                                                                                                                                                                                                                                                                                                                                                                            TCACCAAATTGTGTCAACAATATCCGCCTAAAACAGCAATGGGTAGATGTTAACCTCAAATGGGACCCAGCAAAATACGGTGGCGTAAAGAAGCTTCGAATTCCTTCGAGTGAGGTTTGGTGCCCAGATTTGGTTCTTTATAACAATGCAGATGGTGACTTTGCCATTTCCAAGGACACTAAAATCCTTCTGGAACACACCGGAAAGATAACATGGACACCCCCAGCGATTTTCAAAAGCTACTGTGAAATTATAGTCACACACTTTCCATTTGACCAGCAGAACTGCAGCATGAAGTTTGGCACTTGGACTTATGATGGCACCTTAGTAGTTATAAACCCGGACAGGGACCGACCAGATCTGAGCAACTTCATGGCAAGTGGAGAATGGATGATGAAGGATTATCGCTGCTGGAAGCATTGGGTTTATTATACCTGTTGCCCAGATAAGCCATATCTGGATATTACCTACCACTTTGTCCTACAAAGGCTTCCCCTCTATTTCATTGTCAACGTCATCATTCCTTGTCTGCTCTTCTCTTTCCTCACTGGCTTAGTATTTTACCTGCCTACTGATTCAGGAGAGAAAATGACGCTAAGCATTTCTGTCTTACTGTCCCTGACTGTGTTCCTTCTGGTCATCGTCGAGCTGATCCCTTCAACATCGAGCGCTGTCCCTTTAATTGGGAAATACATGTTATTCACCATGGTCTTTGTCATCGCTTCTATCATTATCACAGTCATCGTCATCAACACCCATCACCGCTCCCCAAGCACTCACACCATGCCTCCGTGGGTGAGAAAGATTTTCATAGACACCATCCCAACATTTATGTCTTCTCTACNCATGAACGTCCTTCACAAGAAAAACAGCCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)