Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:6993161.5                      12 END     3          75       30                Synaptotagmin-like 2 [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABK7515.3                           10 END     1          25       10                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012091770 Xt7.1-CBXT17003.3 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CBXT17003.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGGGACGGAGCAAAACCCAGCCATCCTGGTCAATCTCCAGCCAAGGACCCCTCTATCTCCAGACTTCCTTTGCAGTCGAGGTCGGATTAGTGTTGCTTTGAAATATGTACCACAGGGGGCAGAAGGCCTAGGACTCCCTCCCACTGGGGAACTCCATGTTTGGATTAAGGAGGCACGGCAACTTGTACCTCACAAGGCTGGGAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTCCCTGATTCCGTTCCATCCAACTTCCAGAACACACGTGTGATCCCACATAGCTTGCACCCGATGTTTAACCACACTATGGTGTATGATGGCTTCAGTGGAGAGGACCTCAAAGAAGCCTGTGTGGAATGCACCATCTGGGACCAGGGGAAAATAGGAAGTCGATCCCTTGGGGGCATTCGTCTCAGCACTGGAAAAGGAAGCAGCTATGAAACAAGTGTCAGCTGGATGGATTCCACAGTGGAGGAGAAGGCATTCTGGGAGTCGGTTATAAATAATCCTGGGGAGTGGGTAGAGGCAGTGCTGCCACTGAGACAAAATTTAACTTCACGTTGACAGACTGATTAATTCCAGTTAAAAAGGTGACCTACAAAAGAGACTACCCCTGGCAATAATACTAACACCCTAGGCTGATGAACATTTTTGATTCCATGCAGACAGTTCATACTCAGGGCTCGCTGACAACTGCTGCATATAATCCCAAGTGGAACCAATCGTGGGCGAACGTGACCCCACACCCCATCCCACCATGCCAATTTTATTAATTGGGAGGAAAGATAGAAATATAGGAGATCTAGTCTAATTTTGTCCAGAAACACTGCCAACCCTATCATAAGATAACCACTCAGCTGTTAATACAGGGACAACACCTGATGCCTCAGTAGAGACAGGAACTACCTACCTTCACTTTACACCAGCTGAGAGTGCTTGCATGACCTTCACAAAGAAGAATATTTTTGAACGACTTGGAGACAGCAACTGAGTTCACAGTGTCATCAACAGAATTCTGAAGCCCCATGAAAACAAAAAAATGATACTACAAGCAGTGGAGAGCATGCATACCCATTATAAAGGACAGAACACAGCAAATTTGTATGAAAGTAAAATCTAGTAAAGAGTATGCCAGTTTTAGAGGAGAATATGTACAGAAAAGTTGAATGTTTTTTGGGCACAGTTGCATATTAGCTGGAAAATAATAAATAAACAAGAATAAAGTACAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008246696                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGGAGCAAAACCCAGCCATCCTGGTCAATCTCCAGCCAAGGACCCCTCTATCTCCAGACTTCCTTTGCAGTCGAGGTCGGATTAGTGTTGCTTTGAAATATGTACCACAGGGGGCAGAAGGCCTAGGACTCCCTCCCACTGGGGAACTCCATGTTTGGATTAAGGAGGCACGGCAACTTGTACCTCACAAGGCTGGGAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTCCCTGATTCCGTTCCATCCAACTTCCAGAACACACGTGTGATCCCACATAGCTTGCACCCGATGTTTAACCACACTATGGTGTATGATGGCTTCAGTGGAGAGGACCTCAAAGAAGCCTGTGTGGAATGCACCATCTGGGACCAGGGGAAAATAGGAAGTCGATCCCTTGGGGGCATTCGTCTCAGCACTGGAAAAGGAAGCAGCTATGAAACAAGTGTCAGCTGGATGGATTCCACAGTGGAGGAGAAGGCATTCTGGGAGTCGGTTATAAATAATCCTGGGGAGTGGGTAGAGGCAGTGCTGCCACTGAGACAAAATTTAACTTCACGTTGACAGACTGATTAATTCCAGTTAAAAAGGTGACCTACAAAAGAGACTACCCCTGGCAATAATACTAACACCCTAGGCTGATGAACATTTTTGATTCCATGCAGACAGTTCATACTCAGGGCTCGCTGACAACTGCTGCATATAATCCCAAGTGGAACCAATCGTGGGCGAACGTGACCCCACACCCCATCCCACCATGCCAATTTTATTAATTGGGAGGAAAGATAGAAATATAGGAGATCTAGTCTAATTTTGTCCAGAAACACTGCCAACCCTATCATAAGATAACCACTCAGCTGTTAATACAGGGACAACACCTGATGCCTCAGTAGAGACAGGAACTACCTACCTTCACTTTACACCAGCTGAGAGTGCTTGCATGACCTTCACAAAGAAGAATATTTTTGAACGACTTGGAGACAGCAACTGAGTTCACAGTGTCATCAACAGAATTCTGAAGCCCCATGAAAACAAAAAAATGATACTACAAGCAGTGGAGAGCATGCATACCCATTATAAAGGACAGAACACAGCAAATTTGTATGAAAGTAAAATCTAGTAAAGAGTATGCCAGTTTTAGAGGAGAATATGTACAGAAAAGTTGAATGTTTTTTGGGCACAGTTGCATATTAGCTGGAAAATAATAAATAAACAAGAATAAAGTACAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1
                                                                       ...PROTEIN --- Dm ---- 2e-028     NP_001014625.1 CG33555-PB, isoform B [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 4e-048     NP_001071268.1 hypothetical protein LOC777759 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 3e-056     NP_001074358.1 hypothetical protein LOC771987 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 4e-056     NP_113570.1 synaptotagmin-like 1 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-059     NP_116261.1 NADPH oxidase-related, C2 domain-containing protein [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-093     AAH77272.1 Sytl2-prov protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 2e-093     NP_001086662.1 synaptotagmin-like 2 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                    PROTEIN --- Xt ---- 4e-103     AAH75568.1 Synaptotagmin-like 2 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CBXT17003.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TGA---------TAA---------------TGA---------------------------------------------TGATGA------------------------------------------TGA---------------------------------------------TGA------------------------------------------------TAG---------------------------------------------------------TAA------------TAA---------------TGA---------------------------------------------TGA------------------------------------TGA---------------------------------------------------------TGA------------------------------------------------TAA------------------------TGA---TAA---------------ATG------------------ATG---------------------------------------TAG---------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                       ]
  3   1   2       bld Tad5 5g3  out                        XZT56831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGGGACGGAGCAAAACCCAGCCATCCTGGTCAATCTCCAGCCAAGGACCCCTCTATCTCCAGACTTCCTTTGCAGTCGAGGTCGGATTAGTGTTGCTTTGAAATATGTACCACAGGGGGCAGAAGGCCTAGGACTCCCTCCCACTGGGGAACTCCATGTTTGGATTAAGGAGGCACGGCAACTTGTACCTCACAAGGCTGGGAATGTCAGCACTTTTGTAAAGTGCTTTGTGCTCCCTGATTCCGTTCCATCCAACTTCCAGAACACACGTGTGATCCCACATAGCTTGCACCCGATGTTTAACCACACTATGGTGTATGATGGCTTCAGTGGAGAGGACCTCAAAGAAGCCTGTGTGGAATGCACCATCTGGGACCAGGGGAAAATAGGAAGTCGATCCCTTGGGGGCATTCGTCTCAGCACTGGAAAAGGAAGCAGCTATGAAACAAGTGTCAGCTGGATGGATTCCACAGTGGAGGAGAAGGCATTCTGGGAGTCGGTTATAAATAATCCTGGGGAGTGGGTAGAGGCAGTGCTGCCACTGAGACAAAATTTAACTTCACGTTGACAGACTGATTAATTCCAGTTAAAAAGGTGACCTACAAAAGAGACTACCCCTGGCAATAATACTAACACCCTAGGCTGATGAACATTTTTGATTCCATGCAGACAGTTCATACTCAGGGCTCGCTGACAACTGCTGCATATAATCCCAAGTGGAACCAATCGTGGGCGAACGTGACCCCACACCCCATCCCACCATGCCAATTTTATTAATTGGGAGGAAAAAAAAAAAAAAAGG
  5   1   2      seed Tad5      out                        XZT67209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCTTTGTAGCTTTGTGCTCCCTGATTCCGTTCCATCCAACTTCCAGAACACACGTGTGATCCCACATAGCTTGCACCCGATGTTTAACCACACTATGGTGTATGATGGCTTCAGTGGAGAGGACCTCAAAGAAGCCTGTGTGGAATGCACCATCTGGGACCAGGGGAAAATAGGAAGTCGATCCCTTGGGGGCATTCGTCTCAGCACTGGAAAAGGAAGCAGCTATGAAACAAGTGTCAGCTGGATGGATTCCACAGTGGAGGAGAAGGCATTCTGGGAGTCGGTTATAAATAATCCTGGGGAGTGGGTAGAGGCAGTGCTGCCACTGAGACAAAATTTAACTTCACGTTGACAGACTGATTAATTCCAGTTAAAAAGGTGACCTACAAAAGAGACTACCCCTGGCAATAATACTAACACCCTAGGCTGATGAACATTTTTGATTCCATGCAGACAGTTCATACTCAGGGCTCGCTGACAACTGCTGCATATAATCCCAAGTGGAACCAATCGTGGGCGAACGTGACCCCACACCCCATCCCACCATGCCAATTTTATTAATTGGGAGGAAAGATAGAAATATAGGAGATCTAGTCTAATTTTGTCCAGAAACACTGCCAACCCTATCATAAGATAACCACTCAGCTGTTAATACAGGGACAACACCTGATGCCTCAGTAGAGACAGGAACTACCTACCTTCACTTTACACCAGCTGAGAGTGCTTGCATGACCTTCACAAAGAAGAATATTTTTGAACGACTT
  3   1   2       bld Sto1 5g3  out                        CABG1743.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGGAGGAGAAGGCATTCTGGGAGTCGGTTATAAATAATCCTGGGGAGTGGGTAGAGGCAGTGCTGCCACTGAGACAAAATTTAACTTCACGTTGACAGACTGATTAATTCCAGTTAAAAAGGTGACCTACAAAAGAGACTACCCCTTGGCAATAATACTAACACCCTAGGCTGATGAACATTTTTGATTCCATGCAGACAGTTCATACTCAGGGCTCGCTGACAACTGCTGCATATAATCCCAAGTGGAACCAATCGTGGGCGAACGTGACCCCACACCCCATCCCACCATGCCAATTTTATTAATTGGGAGGAAAGATAGAAATATAGGAGATCTAGTCTAATTTTGTCCAGAAACACTGCCAACCCTATCATAAGATAACCACTCAGCTGTTAATACAGGGACAACACCTGATGCCTCAGTAGAGACAGGAACTACCTACCTTCACTTTACACCAGCTGAGAGTGCTTGCATGACCTTCACAAAGAAGAATATTTTTGAACGACTTGGAGACAGCAACTGAGTTCACAGAGTCATCAACAGAATTCTGAAGCCCCATGAAAACAAAAAAATGATACTACAAGCAGTGGAGAGCATGCATACCCATTATAAAGGACAGAACACAGCAAATTTGTATGAAAGTAAAATCTAGTAAAGAGTATGCCAGTTTTAGAGGAGAATATGTACAGAAAAGTTGAATGTTTTTTGGGCACAGTTGCATATTAGCTGGAAAATAATAAATAAACAAGAATAAAGT
  3   1   2       bld Tbd1 5g3  out                       CBXT17003.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGAGAAGGCATTCTGGGAGTCGGTTATAAATAATCCTGGGGAGTGGGTAGAGGCAGTGCTGCCACTTAGACAAAATTTAACTTCACGTTGACAGACTGATTAATTCCAGTTAAAAAGGTGACCTACAAAAGAGACTACCCCTGGCAATAATACTAACACCCTAGGCTGATGAACATTTTTGATTCCATGCAGACAGTTCATACTCAGGGCTCGCTGACAACTGCTGCATATAATCCCAAGTGGAACCAATCGTGGGCGAACGTGACCCCATACCCCACCCCACCATGCCAATTTTATTAATTGGGAGGAAAGATAGAAATATAGGAGATCTAGTCTAATTTTGTCCAGAAACACTGCCAACCCTATCATAAGATAACCACTCAGCTGTTAATACAAGGACAACACCTGATGCCTCAGTAGAGACAGGAACTACCTACCTTCACTTTACACCAGCTGAGAGTGCTTGCATGACCTTCACAAAGAAGAATATTTTTGAACGACTTGGAGACAGCAACTGAGTTCACAGTGTCATCAACAGAATTCTGAAGCCCCATGAAAACAAAAAAATGATACTACAAGCAGTGGAGAGCATGCATACCCATTATAAAGGACAGAACACAGCAAATTTGTATGAAAGTAAAATCTAGTAAAGAGTATGCCAGTTTTAGAGGAGAATATGTACAGAAAAGTTGAATGTTTTTTGGGCACAGTTGCATATTAGCTGGAAAATAATAAATAAACAAGAATAAAGTACAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)