Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAQ1553.3                           10 END     2          50       20                BMP5 protein [Gallus gallus]

 This cluster: approximate FL confidence score = 97%

 1012091863 Xt7.1-THdA005d10.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-THdA005d10.5 GGCAGTTTGCTCTGTGTCTGTGACTGCGCTCTATGTAAGTGCAAATAGGAGAGGGACACCGCAAGGCGTTTAATGCACTTATATCCATTTTGCAAAGTAATTCATCTGTAAGAACGGGATGTCCATTGGCAAGAGGAGCAAGTGCTAACGTTGTCAGGGCGTTTGCTGAGTGCAAATAGCAAGGTTTAATGTGCGAGTGGCTTAGGGTTTCAGTACAAAGTGAGCTTGGGCAGAGAACTTGATGCAATGTAGTAACTCTGAGCTTTCACTACAGGGGGTGCCCGGGAGATGGGAATGACTGAATCATGGACATTTGCCTGAAGGAGACTTCTCATATGGTATTTAGATTGCACCAGAACAGCTATTGGGACCTCTAGAAGAGATTCTTGAACATGTCCCAGTCGGGATTGGCATTGACCTAAGATAGATTGGCTTGCATTGTTGACCTTAAGGTGAGGACTTTACTGGGTTGGATAACTGAAAGGGAAGCTGCCAAGGACTCCTATCCCTTGAGAAAATGATTGTGGACACCTATCTCCTTAGGGTGCTGGTGGTGCTGTTCTGCAGTTGCCATGTTGTGCGCGCTTTGCCTGGAAACCATGTCCACTCCAGCTTCATCTACAGAAGACTCCGGAATCATGAAAGAAAGGAGATTCAAAGGGAAATCCTGTCTATTTTGGGTTTACCCCACAGACCCAGACCATTCTCCCCCGGGAAACAGGCCTCTTCTGCCCCACTTTTCATGCTGGACTTGTACAACGCTATGGCTAAGGAAGATGACCACAGCATGTTGGGGTACACACTAAGTGGGGCAATGTTAGAGAGTAGGGGTCTGAGAAAGGGTTACCCTGTCGTTGCCAACGGCTACTCGCGAAAAGCCCAGGCTTACCGGAACGCTCCACTTACCACCCAGCGCCCACCTTTAGCCAGCCTGCAGGATTCCAACTTCCTCAACGATGCAGATATGGTCATGAGCTTCGTCAACCTAGTTGAAAGAGACAAGGACTTTTCACACAATCGAAGGCACTATAAAGAATTTCGTTTTGATCTTACCCAAATCCCACATGGAGAAGCAGTGACAGCCGCTGAATTCAGGATTTACAAGGATCGAAGCAACAATCGTTTTGGGAATGAAACACTTAAAATTAGTATTTATCAGATCATCAAGGACTATTCAAACAGGGATGCTGATCTCTTCTTGCTAGACACGCAGAGAGTTCAGACATATGATGTTGGCTGGCTTGTGTTTGATATTACTGTAACCAGTAACCACTGGGTTATCAACCCACAGAACAATCTTGGGTTGCAACTATGTGCTGAAACTAGTGATGGTCGGAGTGTTAGTGTTAAGTCAGCCGGCCTCATTGGAAGACATGGCCCACAGTCCAAACAACCTTTTCTGGTGCCTTCTTCAAA
                                                  Xt7.1-CHK-1008246782       TTGCTCTGTGTCTGTGACTGCGCTCTATGTAAGTGCAAATAGGAGAGGGACACCGCAAGGCGTTTAATGCACTTATATCCATTTTGCAAAGTAATTCATCTGTAAGAACGGGATGTCCATTGGCAAGAGGAGCAAGTGCTAACGTTGTCAGGGCGTTTGCTGAGTGCAAATAGCAAGGTTTAATGTGCGAGTGGCTTAGGGTTTCAGTACAAAGTGAGCTTGGGCAGAGAACTTGATGCAATGTAGTAACTCTGAGCTTTCACTACAGGGGGTGCCCGGGAGATGGGAATGACTGAATCATGGACATTTGCCTGAAGGAGACTTCTCATATGGTATTTAGATTGCACCAGAACAGCTATTGGGACCTCTAGAAGAGATTCTTGAACATGTCCCAGTCGGGATTGGCATTGACCTAAGATAGATTGGCTTGCATTGTTGACCTTAAGGTGAGGACTTTACTGGGTTGGATAACTGAAAGGGAAGCTGCCAAGGACTCCTATCCCTTGAGAAAATGATTGTGGACACCTATCTCCTTAGGGTGCTGGTGGTGCTGTTCTGCAGTTGCCATGTTGTGCGCGCTTTGCCTGGAAACCATGTCCACTCCAGCTTCATCTACAGAAGACTCCGGAATCATGAAAGAAAGGAGATTCAAAGGGAAATCCTGTCTATTTTGGGTTTACCCCACAGACCCAGACCATTCTCCCCCGGGAAACAGGCCTCTTCTGCCCCACTTTTCATGCTGGACTTGTACAACGCTATGGCTAAGGAAGATGACCACAGCATGTTGGGGTACACACTAAGTGGGGCAATGTTAGAGAGTAGGGGTCTGAGAAAGGGTTACCCTGTCGTTGCCAACGGCTACTCGCGAAAAGCCCAGGCTTACCGGAACGCTCCACTTACCACCCAGCGCCCACCTTTAGCCAGCCTGCAGGATTCCAACTTCCTCAACGATGCAGATATGGTCATGAGCTTCGTCAACCTAGTTGAAAGAGACAAGGACTTTTCACACAATCGAAGGCACTATAAAGAATTTCGTTTTGATCTTACCCAAATCCCACATGGAGAAGCAGTGACAGCCGCTGAATTCAGGATTTACAAGGATCGAAGCAACAATCGTTTTGGGAATGAAACACTTAAAATTAGTATTTATCAGATCATCAAGGACTATTCAAACAGGGATGCTGATCTCTTCTTGCTAGACACGCAGAGAGTTCAGACATATGATGTTGGCTGGCTTGTGTTTGATATTACTGTAACCAGTAACCACTGGGTTATCAACCCACAGAACAATCTTGGGTTGCAACTATGTGCTGAAACTAGTGATGGTCGGAGTGTTAGTGTTAAGTCAGCCGGCCTCATTGGAAGACATGGCCCACAGTCCAAACAACCTTTTCTGGTGCCTTC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     517     214 
                                               BLH MIN     517      89 
                                               BLH MPR     268      89 
                                               BLH OVR     517     864 
                                               CDS MIN     517      89 
                                               ORF LNG     517      52 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bf ==== 2e-008     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 2e-009     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] ----------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 4e-014     NP_477340.1 glass bottom boat CG5562-PA [Drosophila melanogaster] -----------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Sp ---- 6e-020     NP_999820.1 SpBMP-5-8 protein [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 1e-036     BAE06333.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 4e-084     AAD09399.1 osteogenic protein-1 homolog precursor [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- ?? ---- 4e-084     NP_001080866.1 bone morphogenetic protein 7 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xt ---- 5e-085     NP_989197.1 bone morphogenetic protein 7; osteogenic protein 1 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dr ---- 8e-113     NP_957345.1 bone morphogenetic protein 5 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 3e-125     NP_031581.2 bone morphogenetic protein 5 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 6e-130     NP_066551.1 bone morphogenetic protein 5 preproprotein [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Gg ==== 2e-131     NP_990479.1 BMP5 protein [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-THdA005d10.5                                                                       TAA------------------------TAA------------------ATG------------------------TAA------------------TGA---------------------------------TAG---------------TGA------------------ATG---------------------------------------------------TGA---------------------------------------------TAG------------------------------------------------------------------------------TAG---------------TGA---TAA---------------------------TGA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  0   1   1           HeRe FLt3                 EC2CAA41AA04.FL-Pollet                                                                                                                                                                                                                                                                           gactacagggggtgcccgggagatgggaatgactgaatcatggacatttgcctgaaggagacttcTCATATGGTATTTAGATTGCACCAGAACAGCTATTGGGACCTCTAGAAGAGATTCTTGAACATGTCCCAGTCGGGATTGGCATTGACCTAAGATAGATTGGCTTGCATTGTTGACCTTAAGGTGAGGACTTTACTGGGTTGGATAACTGAAAGGGAAGCTGCCAAGGACTCCTATCCCTTGAGAAAATGATTGTGGACACCTATCTCCTTAGGGTGCTGGTGGTGCTGTTCTGCAGTTGCCATGTTGTGCGCGCTTTGCCTGGAAACCATGTCCACTCCAGCTTCATCTACAGAAGACTCCGGAATCATGAAAGAAAGGAGATTCAAAGGGAAATCCTGTCTATTTTGGGTTTACCCCACAGACCCAGACCATTCTCCCCCGGGAAACAGGCCTCTTCTGCCCCACTTTTCATGCTGGACTTGTACAACGCTATGGCTAAGGAAGATGACCACAGCATGTTGGGGTACACACTAAGTGGGGCAATGTTAGAGAGTAGGGGTCTGAGAAAGGGTTACCCTGTCGTTGCCAACGGCTACTCGCGAAAAGCCCAGGCTTACCGGAACGCTCCACTTACCACCCAGCGCCCACCTTTAGCCAGCCTGCAGGATTCCAACTTCCTCAACGATGCAGATATGGTCATGAGCTTCGTCAACCTAGTTGAAAGAGACAAGGACTTTTCACACAATCGAAGGCACTATAAAGAATTTCGTTTTGATCTTACCCAAATCCCACATGGAGAAGCAGTGACAGCCGCTGAATTCAGGATTTACAAGGATCGAAGCAACAATCGTTTTGGGAATGAAACACTTAAAATTAGTATTTATCAGATCATCAAGGACTATTCAAACAGGGATGCTGATCTCTTCTTGCTAGACACGCAGAGAGTTCAGACATATGATGTTGGCTGGCTTGTGTTTGATATTACTGTAACCAGTAACCACTGGGTTATCAACCCACAGAACAATCTTGGGTTGCAACTATGTGCTGAAACTAGTGATGGTCGGAGTGTTAGTGTTAAGTCAGCCGGCCTCATTGGAAGACATGGCCCACAGTCCAAACAACCTTTTCTGGTtgCCTTCTtcAAAGCAagtgaaGtctgtacg
  5   1   2   12  bld Tad5 5g3  out                        XZT71368.5p GGCAGTTTGCTCTGTGTCTGTGACTGCGCTCTATGTAAGTGCAAATAGGAGAGGGACACCGCAAGGCGTTTAATGCACTTATATCCATTTTGCAAAGTAATTCATCTGTAAGAACGGGATGTCCATTGGCAAGAGGAGCAAGTGCTAACGTTGTCAGGGCGTTTGCTGAGTGCAAATAGCAAGGTTTAATGTGCGAGTGGCTTAGGGTTTCAGTACAAAGTGAGCTTGGGCAGAGAACTTGATGCAATGTAGTAACTCTGAGCTTTCACTACAGGGGGTGCCCGGGAGATGGGAATGACTGAATCATGGACATTTGCCTGAAGGAGACTTCTCATATGGTATTTAGATTGCACCAGAACAGCTATTGGGACCTCTAGAAGAGATTCTTGAACATGTCCCAGTCGGGATTGGCATTGACCTAAGATAGATTGGCTTGCATTGTTGACCTTAAGGTGAGGACTTTACTGGGTTGGATAACTGAAAGGGAAGCTGCCAAGGACTCCTATCCCTTGAGAAAATGATTGTGGACACCTATCTCCTTAGGGTGCTGGTGGTGCTGTTCTGCAGTTGCCATGTTGTGCGCGCTTTGCCTGGAAACCATGTCCACTCCAGCTTCATCTACAGAAGACTCCGGAATCATGAAAGAAAGGAGATTCAAAGGGAAATCCTGTCTATTTTGGGTTTACCCCACAGACCCAGACCATTCTCCCCCGGGAAACAGGCCTCTTCTGCCCCACTTTTCATGCTGGACTTGTACAACGCTATGGCTAAGGAAGATGACCACAGCATGTTGGGGTACACACTAAGTGGGGCAATGTTAGAGAGTAGGGG
  5   1   2       bld HeRe FLt3 in                     EC2CAA41AA04.g1                                                                                                                                                                                                                                                                           GACTACAGGGGGTGCCCGGGAGATGGGAATGACTGAATCATGGACATTTGCCTGAAGGAGACTTCTCATATGGTATTTAGATTGCACCAGAACAGCTATTGGGACCTCTAGAAGAGATTCTTGAACATGTCCCAGTCGGGATTGGCATTGACCTAAGATAGATTGGCTTGCATTGTTGACCTTAAGGTGAGGACTTTACTGGGTTGGATAACTGAAAGGGAAGCTGCCAAGGACTCCTATCCCTTGAGAAAATGATTGTGGACACCTATCTCCTTAGGGTGCTGGTGGTGCTGTTCTGCAGTTGCCATGTTGTGCGCGCTTTGCCTGGAAACCATGTCCACTCCAGCTTCATCTACAGAAGACTCCGGAATCATGAAAGAAAGGAGATTCAAAGGGAAATCCTGTCTATTTTGGGTTTACCCCACAGACCCAGACCATTCTCCCCCGGGAAACAGGCCTCTTCTGCCCCACTTTTCATGCTGGACTTGTACAACGCTATGGCTAAGGAAGATGACCACAGCATGTTGGGGTACACACTAAGTGGGGCAATGTTAGAGAGTAGGGGTCTGAGAAAGGGTTACCCTGTCGTTGCCAACGGCTACTCGCGAAAAGCCCAGGCTTACCGGAACGCTCCACTTACCACCCAGCGCCCACCTTTAGCCAGCCTGCAGGAT
  5   1   2      seed HdA  5g3  out                  THdA005d10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                            CATTGACCTAAGATAGATTGGCTTGCATTGTTGACCTTAAGGTGAGGACTTTACTGGGTTGGATAACTGAAAGGGAAGCTGCCAAGGACTCCTATCCCTTGAGAAAATGATTGTGGACACCTATCTCCTTAGGGTGCTGGTGGTGCTGTTCTGCAGTTGCCATGTTGTGCGCGCTTTGCCTGGAAACCATGTCCACTCCAGCTTCATCTACAGAAGACTCCGGAATCATGAAAGAAAGGAGATTCAAAGGGAAATCCTGTCTATTTTGGGTTTACCCCACAGACCCAGACCATTCTCCCCCGGGAAACAGGCCTCTTCTGCCCCACTTTTCATGCTGGACTTGTACAACGCTATGGCTAAGGAAGATGACCACAGCATGTTGGGGTACACACTAAGTGGGGCAATGTTAGAGAGTAGGGGTCTGAGAAAGGGTTACCCTGTCGTTGCCAACGGCTACTCGCGAAAAGCCCAGGCTTACCGGAACGCTCCACTTACCACCCAGCGCCCACCTTTAGCCAGCCTGCAGGATTCCAACTTCCTCAACGATGCAGATATGGTCATGAGCTTCGTCAACCTAGTTGAAAGAGACAAGGACTTTTCACACAATCGAAGGCACTATAAAGAATTTCGTTTTGATCTTACCCAAATCCCACATGGAGAAGCAGTGACAGCCGCTGAATTCAGGATTTACAAGGATCGAAGCAACAATCGTTTTGGGAATGAAACACTTAAAATTAGTATTTATCAGATCATCAAGGACTATTCAAACAGGGATGCTGATCTCTTCTTGCT
  3   1   2       bld HeRe FLt3 in                     EC2CAA41AA04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGACCCAGACCATTCTCCCCCGGGAAACAGGCCTCTTCTGCCCCACTTTTCATGCTGGACTTGTACAACGCTATGGCTAAGGAAGATGACCACAGCATGTTGGGGTACACACTAAGTGGGGCAATGTTAGAGAGTAGGGGTCTGAGAAAGGGTTACCCTGTCGTTGCCAACGGCTACTCGCGAAAAGCCCAGGCTTACCGGAACGCTCCACTTACCACCCAGCGCCCACCTTTAGCCAGCCTGCAGGATTCCAACTTCCTCAACGATGCAGATATGGTCATGAGCTTCGTCAACCTAGTTGAAAGAGACAAGGACTTTTCACACAATCGAAGGCACTATAAAGAATTTCGTTTTGATCTTACCCAAATCCCACATGGAGAAGCAGTGACAGCCGCTGAATTCAGGATTTACAAGGATCGAAGCAACAATCGTTTTGGGAATGAAACACTTAAAATTAGTATTTATCAGATCATCAAGGACTATTCAAACAGGGATGCTGATCTCTTCTTGCTAGACACGCAGAGAGTTCAGACATATGATGTTGGCTGGCTTGTGTTTGATATTACTGTAACCAGTAACCACTGGGTTATCAACCCACAGAACAATCTTGGGTTGCAACTATGTGCTGAAACTAGTGATGGTCGGAGTGTTAGTGTTAAGTCAGCCGGCCTCATTGGAAGACATGGCCCACAGTCCAAACAACCTTTTCTGGTGCCTTCTTCAAAGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)