Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 335.0    0Xt7.1-CAAL9968.3                           15 PI      80        657     1087                LOC494704 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012091939 Xt7.1-CAAQ660.5 - 6 ESTs
                                                                       ..-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CAAQ660.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCCGAGGCAGAAAGGTTCCAAACAAGACAAGCACTACATGGATTATAACCAAAGGAAGTCTAGGTATAAATAGTTTTATTCATTTCAGATCCGGACAATTCTAGCATGTCATCCTGGAGAAGACGTCATTGCTTCCCTCTTGGGTGGAACTGGCATACCAGGCGCTTCATGTTCCATTGCTTTGTATTACTGGTCCTTTTCTTCTTTATGTTTGTTTTGTTTCATAATAATCGATGGCTTCCGAGGCAGATAATGGACAAAGGAATCATTCAGGTGGATAATACCAATAGTTTCCAGTCAAAGGAAAGTGAAACAATATCAAAGATGCTCCAGAAGTTAGTTGTCTTCAGTCTGAAGAACAATCGGTCTTATCACAAAAAGGTCTTACGTCAAAGAGTGACTACTGCGGAAATTACGTCTAACAGGGTGTCTCAGAATACACTGCATTATGGTTATATAATTAATGAGCCTGACAAATGCCAGAAAAGCACTCCATTTCTCATTCTGCTAATAGCAGTGGAACCACAGCAGCTAAGTGCTCGTGAGGCTATAAGGCAAACTTGGGGAAAGGAAGACCTTTTCCATGGAATTCTGATTGTTAAGTTGTTTTTGCTTGGCAGAGATTCTAAAGGAACGGACAGAACTGACCAGGCAATTGTGGATGAAAGTAACCAATACCATGACATCATCCAGCAGGATTATTTAGACACCTACAACAATCTGACAATTAAAACCCTAATGGGAATGCACTGGATAGCCACTTTTTGTCCAAACGTTTCATATATCATGAAGACAGACAGTGATATGTTTGTGAACACTGAGCACTTAATATACAGGCTTCTGAAGCCTGACGCAGCACCACAAACAAACTATTTCACAGGATATTTTATGAAAGGGTATGCGCCCAATCGTAATAAAAACAGTAAATGGTACATGCCCCCGGAGCTATACCCCGGAGATCTATATCCCCCATTTTGTTCTGGGACAGGCTACGTGTTCTCTGGGGACCTAGCAGAGAAGATATATAAAGTTTCTTTGAGTATTCCACGTTTGCATTTAGAGGATGTATACATTGGTGTTTGTCTTGAAAAATTAGGCATAAAGCCAGTGCCCCCTCCCAAAGAATCTTATTTTAATA
                                                  Xt7.1-CHK-1008241922                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCAGAAAGGTTCCAAACAAGACAAGCACTACATGGATTATAACCAAAGGAAGTCTAGGTATAAATAGTTTTATTCATTTCAGATCCGGACAATTCTAGCATGTCATCCTGGAGAAGACGTCATTGCTTCCCTCTTGGGTGGAACTGGCATACCAGGCGCTTCATGTTCCATTGCTTTGTATTACTGGTCCTTTTCTTCTTTATGTTTGTTTTGTTTCATAATAATCGATGGCTTCCGAGGCAGATAATGGACAAAGGAATCATTCAGGTGGATAATACCAATAGTTTCCAGTCAAAGGAAAGTGAAACAATATCAAAGATGCTCCAGAAGTTAGTTGTCTTCAGTCTGAAGAACAATCGGTCTTATCACAAAAAGGTCTTACGTCAAAGAGTGACTACTGCGGAAATTACGTCTAACAGGGTGTCTCAGAATACACTGCATTATGGTTATATAATTAATGAGCCTGACAAATGCCAGAAAAGCACTCCATTTCTCATTCTGCTAATAGCAGTGGAACCACAGCAGCTAAGTGCTCGTGAGGCTATAAGGCAAACTTGGGGAAAGGAAGACCTTTTCCATGGAATTCTGATTGTTAAGTTGTTTTTGCTTGGCAGAGATTCTAAAGGAACGGACAGAACTGACCAGGCAATTGTGGATGAAAGTAACCAATACCATGACATCATCCAGCAGGATTATTTAGACACCTACAACAATCTGACAATTAAAACCCTAATGGGAATGCACTGGATAGCCACTTTTTGTCCAAACGTTTCATATATCATGAAGACAGACAGTGATATGTTTGTGAACACTGAGCACTTAATATACAGGCTTCTGAAGCCTGACGCAGCACCACAAACAAACTATTTCACAGGATATTTTATGAAAGGGTATGCGCCCAATCGTAATAAAAACAGTAAATGGTACATGCCCCCGGAGCTATACCCCGGAGATCTATATCCCCCATTTTGTTCTGGGACAGGCTACGTGTTCTCTGGGGACCTAGCAGAGAAGATATATAAAGTTTCTTTGAGTATTCCACGTTTGCATTTAGAGGATGTATACATTGGTGTTTGTCTTGAAAAATTAGGCATAAAGCCAGTGCCCCCTCCCAAAGAATCTTATTTTAATATTTGGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            2     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     107    1141                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH MIN     107     110                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH OVR     107    1108                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               ORF LNG     107      78                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Cs ---- 7e-010     CAJ84710.1 beta-1,3-galactosyltransferase 6 [Ciona savignyi] ----------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 4e-017     NP_001025003.2 ZK678.8 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 1e-019     BAB00622.1 Not3 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 4e-030     NP_609184.1 CG8668-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 1e-056     XP_001179708.1 PREDICTED: similar to UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase I, partial [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 3e-094     NP_996984.1 hypothetical protein zgc:76904 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Gg ==== 7e-104     XP_001231894.1 PREDICTED: similar to UDP-galactose:2-acetamido-2-deoxy-D- glucose3beta-galactosyltransferase [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 3e-104     NP_064409.2 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 8e-107     NP_003774.1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase 2; beta-3-galt2 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 6e-108     AAH80111.1 MGC84681 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 6e-108     NP_001087567.1 MGC84681 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          AAH75347.1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CAAQ660.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAA------------TAG---TAA------------------------------------ATG------------------------------------------------------------ATG------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------ATG---------------ATG---------------------------------------------------------------------------------ATG------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   1           AbdN FL                     IMAGE:7005158.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTATGACTGCCCGAGGCAGAAAGGTTCCAAACAAGACAAGCACTACATGGATTATAACCAAAGGAAGTCTAGGTATAAATAGTTTTATTCATTTCAGATCCGGACAATTCTAGCATGTCATCCTGGAGAAGACGTCATTGCTTCCCTCTTGGGTGGAACTGGCATACCAGGCGCTTCATGTTCCATTGCTTTGTATTACTGGTCCTTTTCTTCTTTATGTTTGTTTTGTTTCATAATAATCGATGGCTTCCGAGGCAGATAATGGACAAAGGAATCATTCAGGTGGATAATACCAATAGTTTCCAGTCAAAGGAAAGTGAAACAATATCAAAGATGCTCCAGAAGTTAGTTGTCTTCAGTCTGAAGAACAATCGGTCTTATCACAAAAAGGTCTTACGTCAAAGAGTGACTACTGCGGAAATTACGTCTAACAGGGTGTCTCAGAATACACTGCATTATGGTTATATAATTAATGAGCCTGACAAATGCCAGAAAAGCACTCCATTTCTCATTCTGCTAATAGCAGTGGAACCACAGCAGCTAAGTGCTCGTGAGGCTATAAGGCAAACTTGGGGAAAGGAAGACCTTTTCCATGGAATTCTGATTGTTAAGTTGTTTTTGCTTGGCAGAGATTCTAAAGGAACGGACAGAACTGACCAGGCAATTGTGGATGAAAGTAACCAATACCATGACATCATCCAGCAGGATTATTTAGACACCTACAACAATCTGACAATTAAAACCCTAATGGGAATGCACTGGATAGCCACTTTTTGTCCAAACGTTTCATATATCATGAAGACAGACAGTGATATGTTTGTGAACACTGAGCACTTAATATACAGGCTTCTGAAGCCTGACGCAGCACCACAAACAAACTATTTCACAGGATATTTTATGAAAGGGTATGCGCCCAATCGTAATAAAAACAGTAAATGGTACATGCCCCCGGAGCTATACCCCGGAGATCTATATCCCCCATTTTGTTCTGGGACAGGCTACGTGTTCTCTGGGGACCTAGCAGAGAAGATATATAAAGTTTCTTTGAGTATTCCACGTTTGCATTTAGAGGATGTATACATTGGTGTTTGTCTTGAAAAATTAGGCATAAAGCCAGTGCCCCCTCCCAAAGAATCTTATTTTAATATTTGGAGGGTTTATTATTCAGATTGTGTGTATAACCAGATAGTCACCTCCCATCAGTTCCAGCCTTCAGAACTACTGAAATATTGGAATCAGTTGCAGCAGAACAGGCATGTCTGTAGCAAAACCCCCAAGTAAAGAACAATTCTGATCAATGTTGGGGTACTGTCTGTGGGGCAGCACTTTCTCTACAGCAAGATACCTTCAGGGAAGGGCACTTGCAAAGGAAAAGATAATGTTAATTGCCAAATAAATAAATAAGGTTTATTTTTGCACATTTTGATATGTTCAGCATATTACATGACAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   24  bld Liv1 5g                             CAAR11734.5p ..................................................................GGCATCAGCCTTACATGTAAGTCAACTACATCTGTATGGGAATGGCCTGAAAGCACCTGGTGCACTTCATGGCAGGTGATTATGTCTTGAAAATGCTTACTGGTACACTCTCAAGCAATTCCTATTAAAATGAAAGCAGAGGTGGTTTAGAGCATCTTGTCCCCTGCCCACCAAGCTACCATTGCCCTAGAGATGCTAGAAGAACTGCCCAAAACTGCAGCAGAAGTGAGTCCTTGAAAGTTATTAACAGCAGAAGGAAACACAGAGATAAAATGCTTTACATGCTATAGCCCTGAATATAGAATGGCACTTGTGTTTGATAAGGAATTATCTCTGCCCACATAGCTGAAGTGGACGGGGTGATGTAGAAGTAGGAAAATGTCTTTCATTGGATAGTACTGATCATTTTGCATGTGTATCTGTAATTGTGTTCCTGTTTTGCAGGCAGAAAGGTTCCAAACAAGACAAGCACTACATGGATTATAACCAAAGGAAGTCTAGGTATAAATAGTTTTATTCATTTCAGATCCGGACAATTCTAGCATGTCATCCTGGAGAAGACGTCATTGCTTCCCTCTTGGGTGGAACTGGCATACCAGGCGCTTCATGTTCCATTGCTTTGTATTACTGGTCCTTTTCTTCTTTATGTTTGTTTTGTTTCATAATAATCGATGGCTTCCGAGGCAGATAATGGACAAAGGAATCATTCAGGTGGATAATACCAATAGTTTCCAGTCAAAGGAAAGTGAAACAATATCAAAGATGCTCCAGAAGTTAGTTGTCTTCAGTCTGAAGAACAATCGGTCTTATCACAAAAAGGTCTTACGTCAAAGAGTGACTACTGCGGAAAATACGTCTAACAGGGTGTCTC
  5   1   2      seed BrSp      in                    EC0CBA002DB10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGAAAGGGAGAGGAGCGATCAGAGCTGGAGTCGCAGCCACTATGACTGCCCGAGGCAGAAAGGTTCCAAACAAGACAAGCACTACATGGATTATAACCAAAGGAAGTCTAGGTATAAATAGTTTTATTCATTTCAGATCCGGACAATTCTAGCATGTCATCCTGGAGAAGACGTCATTGCTTCCCTCTTGGGTGGAACTGGCATACCAGGCGCTTCATGTTCCATTGCTTTGTATTACTGGTCCTTTTCTTCTTTATGTTTGTTTTGTTTCATAATAATCGATGGCTTCCGAGGCAGATAATGGACAAAGGAATCATTCAGGTGGATAATACCAATAGTTTCCAGTCAAAGGAAAGTGAAACAATATCAAAGATGCTCCAGAAGTTAGTTGTCTTCAGTCTGAAGAACAATCGGTCTTATCACAAAAAGGTCTTACGTCAAAGAGTGACTACTGCGGAAATTACGTCTAACAGGGTGTCTCAGAATACACTGCATTATGGTTATATAATTAATGAGCCTGACAAATGCCAGAAAAGCACTCCATTTCTCATTCTGCTAATAGCAGTGGAACCACAGCAGCTAAGTGCTCGTGAGGCTATAAGGCAAAC
  5   1   2       bld AbdN FL                            IMAGE:7005158                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTATGACTGCCCGAGGCAGAAAGGTTCCAAACAAGACAAGCACTACATGGATTATAACCAAAGGAAGTCTAGGTATAAATAGTTTTATTCATTTCAGATCCGGACAATTCTAGCATGTCATCCTGGAGAAGACGTCATTGCTTCCCTCTTGGGTGGAACTGGCATACCAGGCGCTTCATGTTCCATTGCTTTGTATTACTGGTCCTTTTCTTCTTTATGTTTGTTTTGTTTCATAATAATCGATGGCTTCCGAGGCAGATAATGGACAAAGGAATCATTCAGGTGGATAATACCAATAGTTTCCAGTCAAAGGAAAGTGAAACAATATCAAAGATGCTCCAGAAGTTAGTTGTCTTCAGTCTGAAGAACAATCGGTCTTATCACAAAAAGGTCTTACGTCAAAGAGTGACTACTGCGGAAATTACGTCTAACAGGGTGTCTCAGAATACACTGCATTATGGTTATATAATTAATGAGCCTGACAAATGCCAGAAAAGCACTCCATTTCTCATTCTGCTAATAGCAGTGGAACCACAGCAGCTAAGTGCTCGTGAGGCTATAAGGCAAACTTGGGGAAAGGAAGACCTTTTCCATGGAATTCTGATTGTTAAGTTGTTTTTGCTTGGCAGAGATTCTAAAGGAACGGACAGAACTGACCAGGCAATTGTGGATGAAAGTAACCAATACCATGACATCATCCAGCAGGATTATTTAGACACCTACAACAATCTGACAATTAAAACCCTAATGGGAATGCACTGGATAGCCACTTTTTTGTCCAAACGTTTCATATATCCTGAAAAACAGACAGTTGATATGGTTTGTGAACCACTGGAGCAACTTTATTATACCAGGGCTTTCCTGAAAA
  5   1   2       bld Hrt1      in                          CAAQ660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAGCACTACATGGATTATAACCAAAGGAAGTCTAGGTATAAATAGTTTTATTCATTTCAGATCCGGACAATTCTAGCATGTCATCCTGGAGAAGACGTCATTGCTTCCCTCTTGGGTGGAACTGGCATACCAGGCGCTTCATGTTCCATTGCTTTGTATTACTGGTCCTTTTCTTCTTTATGTTTGTTTTGTTTCATAATAATCGATGGCTTCCGAGGCAGATAATGGACAAAGGAATCATTCAGGTGGATAATACCAATAGTTTCCAGTCAAAGGAAAGTGAAACAATATCAAAGATGCTCCAGAAGTTAGTTGTCTTCAGTCTGAAGAACAATCGGTCTTATCACAAAAAGGTCTTACGTCAAAGAGTGACTACTGCGGAAATTACGTCTAACAGGGTGTCTCAGAATACACTGCATTATGGTTATATAATTAATGAGCCTGACAAATGCCAGAAAAGCACTCCATTTCTCATTCTGCTAATAGCAGTGGAACCACAGCAGCTAAGTGCTCGTGAGGCTATAAGGCAAACTTGGGGAAAGGAAGACCTTTTCCATGGAATTCTGATTGTTAAGTTGTTTTTGCTTGGCAGAGATTCTAAAGGAACGGACAGAACTGACCAGGCAATTGTGGATGAAAGTAACCAATACCATGACATCATCCAGCAGGATTATTTAGACACCTACAACAATCTGACAATTAANACCCTAATGGGAATGCACTGGATAGCCACTTTTTGTCCAAACGTTTCATATATCATGAAGACAGACAGTGATATGTTTGTGAACACTGAGCACTTAATATACAGGCTTCTGAAGCCTGACGCAG
  3   1   2      skin Hrt1      in                          CAAQ660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGAGATTCTAAAGGAACGGACAGAACTGACCAGGCAATTGTGGATGAAAGTAACCAATACCATGACATCATCCAGCAGGATTATTTAGACACCTACAACAATCTGACAATTAAAACCCTAATGGGAATGCACTGGATAGCCACTTTTTGTCCAAACGTTTCATATATCATGAAGACAGACAGTGATATGTTTGTGAACACTGAGCACTTAATATACAGGCTTCTGAAGCCTGACGCAGCACCACAAACAAACTATTTCACAGGATATTTTATGAAAGGGTATGCGCCCAATCGTAATAAAAACAGTAAATGGTACATGCCCCCGGAGCTATACCCCGGAGATCTATATCCCCCATTTTGTTCTGGGACAGGCTACGTGTTCTCTGGGGACCTAGCAGAGAAGATATATAAAGTTTCTTTGAGTATTCCACGTTTGCATTTAGAGGATGTATACATTGGTGTTTGTCTTGAAAAATTAGGCATAAAGCCAGTGCCCCCTCCCAAAGAATCTTATTTTAATATTTGGAGGGTTTATTATTCAGATTGTGTGTATAACCAGATAGTCACCTCCCATCAGTTCCAGCCTTCAGAACTACTGAAATATTGGAATCAGTTGCAGCAGAACAGGCATGTCTGTAGCAAAACCCCCAAGTAAAGAACAATTCTGATCAATGTTGGGGTACTGTCTGTGGGGCAGCACTTTCTCTACAGCAAGATACCTTCAGGGAAGGGCACTGCAAAGGAAAAGATAATGTTAATTGCCAAATAAATAAATAAGGTTAT
  3   1   2      skin BrSp      in                    EC0CBA002DB10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGCACTTAATATACAGGCTTCTGAAGCCTGACGCAGCACCACAAACAAACTATTTCACAGGATATTTTATGAAAGGGTATGCGCCCAATCGTAATAAAAACAGTAAATGGTACATGCCCCCGGAGCTATACCCCGGAGATCTATATCCCCCATTTTGTTCTGGGACAGGCTACGTGTTCTCTGGGGACCTAGCAGAGAAGATATATAAAGTTTCTTTGAGTATTCCACGTTTGCATTTAGAGGATGTATACATTGGTGTTTGTCTTGAAAAATTAGGCATAAAGCCAGTGCCCCCTCCCAAAGAATCTTATTTTAATATTTTGGAGGGTTTATTATTCAGATTGTGTGTATAACCAGATAGTCACCTCCCATCAGTTCCAGCCTTCAGAACTACTGAAATATTGGAATCAGTTGCAGCAGAACAAGCATGCCTGTAGCAAAACCCCCAAGTAAAGAACAATTCTGATCAATGTTGGGGTACTGTCTGTGGGGCAGCACTTTCTCTACAGCAAGATACCTTCAGGGAAGGGCACTTGCAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)