Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK4985.3                            4 END     1          33       25                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012091983 Xt7.1-XZT25650.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT25650.5 CTTTTCTGCTGCAAGTGCAGGGGCTTAGTCGGTCCCTGTGCCTCGGAAGGACTACGCTGCTCTATGCCGTACATTCCAGTCAAATGTGACTGCACAGGAGACGGCAAGTGCAGACAATCTCCATCGGTGTGGAAGCAGAGTCTGGGAGATCTGCAGTGCTGCCTGGGCTTGAGATCTGGGATCTTATCCCCTTATAGCTGCAGGAACACAAAGGATGCTGTGATCAGACGTGAATTGTGCTCTGTTCCCAGAGCAGGAAGGATTATAGAATGAATGGAAGGCATCCTCAGCGCAGGGAATGAGGCATTTCTTCTTCAACAATGAGGTTTCCCTCCTTTCAGCTTTTCACAAGGTCCTGGGAAGTGAAGGGCTTTGGCCCTGAATCTCTTTGACCTCCCTCTCCCTTCAGGGCAGCTCCTGGGATCCCCAACCTGCTGCAATGGGTAATGAGGAGCACTGGGGTCAGCCCACCCTGGAGATGCTGAAAAGAAGGGACATTCTGGCTATTGTGCTGATCGTTCTGCCCTGGACTTTACTCATCACAGTGTGGCACCACAGCACTCTGTCCCCGCTGCTCACTGCACACAAGGAAGACGGGAGTGAGGGTCGGAGGGATGTGAGCCAAGGCTCTGATTCCAGGGAATATTGTTCCTCTGACCGGGATATTGTGGAGGTTGTAAGGACAGAATATGTGTATACACGGCCCCCACCATGGATGGGAAACCTTCCTATTATCCATGTCATTACCCCAACATACAGCAGACCAGTGCAGAAAGCTGAGCTGACACGCCTATCCAACACCTTATTGCATGTACCCAACCTGCACTGGATCCTGGTGGAGGATTCCCAAAGACGCACTCCTCTAGTCACCAGATTGCTTCAGGATTCTGGCCTCAACTA
                                                  Xt7.1-CHK-1008250556       TGCTGCAAGTGCAGGGGCTTAGTCGGTCCCTGTGCCTCGGAAGGACTACGCTGCTCTATGCCGTACATTCCAGTCAAATGTGACTGCACAGGAGACGGCAAGTGCAGACAATCTCCATCGGTGTGGAAGCAGAGTCTGGGAGATCTGCAGTGCTGCCTGGGCTTGAGATCTGGGATCTTATCCCCTTATAGCTGCAGGAACACAAAGGATGCTGTGATCAGACGTGAATTGTGCTCTGTTCCCAGAGCAGGAAGGATTATAGAATGAATGGAAGGCATCCTCAGCGCAGGGAATGAGGCATTTCTTCTTCAACAATGAGGTTTCCCTCCTTTCAGCTTTTCACAAGGTCCTGGGAAGTGAAGGGCTTTGGCCCTGAATCTCTTTGACCTCCCTCTCCCTTCAGGGCAGCTCCTGGGATCCCCAACCTGCTGCAATGGGTAATGAGGAGCACTGGGGTCAGCCCACCCTGGAGATGCTGAAAAGAAGGGACATTCTGGCTATTGTGCTGATCGTTCTGCCCTGGACTTTACTCATCACAGTGTGGCACCACAGCACTCTGTCCCCGCTGCTCACTGCACACAAGGAAGACGGGAGTGAGGGTCGGAGGGATGTGAGCCAAGGCTCTGATTCCAGGGAATATTGTTCCTCTGACCGGGATATTGTGGAGGTTGTAAGGACAGAATATGTGTATACACGGCCCCCACCATGGATGGGAAACCTTCCTATTATCCATGTCATTACCCCAACATACAGCAGACCAGTGCAGAAAGCTGAGCTGACACGCCTATCCAACACCTTATTGCATGTACCCAACCTGCACTGGATCCTGGTGGAGGATTCCCAAAGACGCACTCCTCTAGTCACCAGATTGCTTCAGGATTCTGGCCT
                                                      consensus depths      1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     439     363 
                                               BLH MIN     439      59 
                                               BLH MPR     379      59 
                                               BLH OVR     439     953 
                                               CDS MIN     439      59 
                                               ORF LNG     439      16 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-012     NP_496076.1 SQuashed Vulva SQV-8, defective SPErmatogenesis SPE-2, 1 3-glucuronyltransferase(41.1 kD) (sqv-8) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 7e-014     NP_726910.1 CG32775-PA [Drosophila melanogaster] ----------------------------------------------------------------===========================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Cs ---- 1e-015     CAI63873.1 beta3-glucuronyltransferase [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 3e-017     CAD98786.1 3-beta-glucuronosyltransferase [Ciona intestinalis] -----------------------------------------------------================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 7e-017     XP_001184566.1 PREDICTED: similar to beta3-glucuronyltransferase, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 2e-034     AAH82886.1 LOC494776 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 5e-060     NP_001015066.1 beta3-glucuronyltransferase [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 1e-060     NP_084068.1 beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) [Mus musculus] =============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 4e-062     NP_473366.1 beta-1,3-glucuronyltransferase 1 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 1e-065     XP_417880.2 PREDICTED: similar to 3-beta-glucuronosyltransferase [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 9e-087     AAI35248.1 Unknown (protein for MGC:121293) [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 9e-087     NP_001090809.1 hypothetical protein LOC100037907 [Xenopus (Silurana) tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT25650.5                          TAG---------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------ATG---TGA------------------------------------------TAG------------------------------ATG------------------------------------------------------------------------------TGA---------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  0   1   1           Tad5 FL                          XZT25650.FL-MGC                               GGTCCCTGTGCCTCGGAAGGACTACGCTGCTCTATGCCGTACATTCCAGTCAAATGTGACTGCACAGGAGACGGCAAGTGCAGACAATCTCCATCGGTGTGGAAGCAGAGTCTGGGAGATCTGCAGTGCTGCCTGGGCTTGAGATCTGGGATCTTATCCCCTTATAGCTGCAGGAACACAAAGGATGCTGTGATCAGACGTGAATTGTGCTCTGTTCCCAGAGCAGGAAGGATTATAGAATGAATGGAAGGCATCCTCAGCGCAGGGAATGAGGCATTTCTTCTTCAACAATGAGGTTTCCCTCCTTTCAGCTTTTCACAAGGTCCTGGGAAGTGAAGGGCTTTGGCCCTGAATCTCTTTGACCTCCCTCTCCCTTCAGGGCAGCTCCTGGGATCCCCAACCTGCTGCAATGGGTAATGAGGAGCACTGGGGTCAGCCCACCCTGGAGATGCTGAAAAGAAGGGACATTCTGGCTATTGTGCTGATCGTTCTGCCCTGGACTTTACTCATCACAGTGTGGCACCACAGCACTCTGTCCCCGCTGCTCACTGCACACAAGGAAGACGGGAGTGAGGGTCGGAGGGATGTGAGCCAAGGCTCTGATTCCAGGGAATATTGTTCCTCTGACCGGGATATTGTGGAGGTTGTAAGGACAGAATATGTGTATACACGGCCCCCACCATGGATGGGAAACCTTCCTATTATCCATGTCATTACCCCAACATACAGCAGACCAGTGCAGAAAGCTGAGCTGACACGCCTATCCAACACCTTATTGCATGTACCCAACCTGCACTGGATCCTGGTGGAGGATTCCCAAAGACGCACTCCTCTAGTCACCAGATTGCTTCAGGATTCTGGCCTCAACTACACACATCTCAATGTAGAGACACCACGTAATTACAAACTAAGAGGTGATACTCGTGACCCACGTATACCTCGCGGGACAATGCAAAGGAATTTGGCCCTGCGCTGGCTCAGGGAAACCTTCAATAGAAACAACAGCTTACCAGGAGTTGTTTATTTTGCTGATGATGATAACACGTACAGCCTTGATCTGTTTGAGGAGATGAGAAGTACAAGGAAGGTATCAGTGTGGCCTGTAGCTTTTGTAGGAGGTCTACGATATGAGTCTCCCAAAGTTAATGCTGCTGGAAAAGTTTTTGGATGGAAGACTGTGTTTGACCCACATAGACCATTCGCTATTGACATGGCTGGCTTTGCTATTAATCTTCGTCTCATCCTTCAGCGTCCACAGGCTTATTTTAAATTAAGAGGAGTTAAAGGAGGTTATCAAGAAAGCAGTCTGCTGAGAGAGCTTGTGACTCTAAATGACCTGGAACCCAAAGCTGACAATTGCACTAAGATTCTGGTGTGGCACACTCGGACAGAGAAGCCAGTGCTTGTAAATGAAGGGAAAAAAGGGTTCACGGATCCCAATGTGGAGATCTAAGAAAAGCCAACGCAGGGACTGCTTGCAGGCATGGTACTTTACATTCTTTGGGCCTATTCTCAGCCTGGTGGATCAAGAGAGTGCTTTTGGAAGCACTTTCTCCAGCACTTACATCCACCTTCCCCTGCCCCGCAGCTTGCACGGGACTCCATGTGTATGTCATTTTATCCAAGAAGCACAGCACATGTGATGGAGGGAATGATGGAGATGGCAAGGCATGAAGAACCCTGTTTTATAGTACCACAGCTTAATCCTTGGTGTTCTCCCATGCTGCTCGAATGATCTAAGAATGGAGCAAAACCTAGGGAAGCTAGAGGTCTAGTGATCTATCTGCCACCTGCAGGAAAGTGTAAGCGAATGCCCCCACTGTAGTGTACCAACTTTTACAGACCTGCAGAGCAAGGATAAGATCTGCTGCAGAGAGTGGGTTACATGTTCCACAGGCAGGGAACCTGGTGGGATACAGGATGCATAAAAACTGCACAATGCCATGTATCACTGTAGTTTGCATGCTCACTGAAAATAAAGAGCAGAGGAAATTCTAAAAAAAAAAAAAAA
  5   1   2       bld Brn2 5g3  out                       CAAJ12236.5p CTTTTCTGCTGCAAGTGCAGGGGCTTAGTCGGTCCCTGTGCCTCGGAAGGACTACGCTGCTCTATGCCGTACATTCCAGTCAAATGTGACTGCACAGGAGACGGCAAGTGCAGACAATCTCCATCGGTGTGGAAGCAGAGTCTGGGAGATCTGCAGTGCTGCCTGAGCTTGAGATCTGGGATCTTATCCCCTTATAGCTGCAGGAACACAAAGGATGCTGTGATCAGACGTGAATTGTGCTCTGTTCCCAGAGCAGGAAGGATTATAGAATGAATGGAAGGCATCCTCAGCGCAGGGAATGAGGCATTTCTTCTTCAACAATGAGGTTTCCCTCCTTTCAGCTTTTCACAAGGTCCTGGGAAGTGAAGGGCTTTGGCCCTGAATCTCTTTGACCTCCCTCTCCCTTCAGGGCAGCTCCTGGGATCCCCAACCTGCTGCAATGGGTAATGAGGAGCACTGGGGTCAGCCCACCCTGGAGATGCTGAAAAGAAGGGACATTCTGGCTATTGTGCTGATCGTTCTGCCCTGGACTTTACTCATCACAGTGTGGCACCACAGCACTCTGTCCCCGCTGCTCACTGCACACAAGGAAGACGGGAGTGAGGGTCGGAGGGATGTGAGCCAAGGCTCTGATTCCAGGGAATATTGTTCCTCTGACCGGGATATTGTGGAGGTTGTAAGGACAGAATATGTGTATACACGGCCCCCACCATGGATGGGAAACCTTCCTATTATCCATGTCATTACCCCAACATACAGCAGACCAGTGCAGAAAGCTGAGCTGACACGCCTATCCAACACCTTATTGCATGTACCCAAACTGCAC
  5   1   2      seed Tad5 FL                              XZT25650.5p                               GGTCCCTGTGCCTCGGAAGGACTACGCTGCTCTATGCCGTACATTCCAGTCAAATGTGACTGCACAGGAGACGGCAAGTGCAGACAATCTCCATCGGTGTGGAAGCAGAGTCTGGGAGATCTGCAGTGCTGCCTGGGCTTGAGATCTGGGATCTTATCCCCTTATAGCTGCAGGAACACAAAGGATGCTGTGATCAGACGTGAATTGTGCTCTGTTCCCAGAGCAGGAAGGATTATAGAATGAATGGAAGGCATCCTCAGCGCAGGGAATGAGGCATTTCTTCTTCAACAATGAGGTTTCCCTCCTTTCAGCTTTTCACAAGGTCCTGGGAAGTGAAGGGCTTTGGCCCTGAATCTCTTTGACCTCCCTCTCCCTTCAGGGCAGCTCCTGGGATCCCCAACCTGCTGCAATGGGTAATGAGGAGCACTGGGGTCAGCCCACCCTGGAGATGCTGAAAAGAAGGGACATTCTGGCTATTGTGCTGATCGTTCTGCCCTGGACTTTACTCATCACAGTGTGGCACCACAGCACTCTGTCCCCGCTGCTCACTGCACACAAGGAAGACGGGAGTGAGGGTCGGAGGGATGTGAGCCAAGGCTCTGATTCCAGGGAATATTGTTCCTCTGACCGGGATATTGTGGAGGTTGTAAGGACAGAATATGTGTATACACGGCCCCCACCATGGATGGGAAACCTTCCTATTATCCATGTCATTACCCCAACATACAGCAGACCAGTGCAGAAAGCTGAGCTGACACGCCTATCCAACACCTTATTGCATGTACCCAACCTGCACTGGATCCTGGTGGAGGATTCCCAAAGACGCACTCCTCTAGTCACCAGATTGCTTCAGGATTCTGGCCTCAACTA
  5   1   2   24  bld Brn2 5g                             CAAJ13726.5p ......................................TGCCTCGGAAGGACTACGCTGCTCTATGCCGTACATTCCAGTCAAATGTGACTGCACAGGAGACGGCAAGTGCAGACAATCTCCATCGGTGTGGAAGCAGAGTCTGGGAGATCTGCAGTGCTGCCTGGGCTTGAGATCTGGGATCTTATCCCCTTATAGCTGCAGGAACACAAAGGATGCTGTGATCAGACGTGAATTGTGCTCTGTTCCCAGAGCAGGAAGGATTATAGAATGAATGGAAGGCATCCTCAGCGCAGGGAATGAGGCATTTCTTCTTCAACAATGAGGTTTCCCTCCTTTCAGCTTTTCACAAGGTCCTGGGAAGTGAAGGGCTTTGGCCCTGAATCTCTTTGACCTCCCTCTCCCTTCAGGGCAGCTCCTGGGATCCCCAACCTGCTGCAATGGGTAATGAGGAGCACTGGGGTCAGCCCACCCTGGAGATGCTGAAAAGAAGGGACATTCTGGCTATTGTGCTGATCGTTCTGCCCTGGACTTTACTCATCACAGTGTGGCACCACAGCACTCTGTCCCCGCTGCTCACTGCACACAAGGAAGACGGGAGTGAGGGTCGGAGGGATGTGAGCCAAGGCTCTGATTCCAGGGAATATTGTTCCTCTGACCGGGATATTGTGGAGGTTGTAAGGACAGAATATGTGTATACACGGCCCCCACCATGGATGGGAAACCTTCCTATTATCCATGTCATTACCCCAACATACAGCAGACCAGTGCAGAAAGCTGAGCTGACACGCCTATCCAACACCTTATTGCATGTACCCAACCTGCACTGGATCCTGGTGGAGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)