Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012092749 Xt7.1-CAAL23442.3 - 9 ESTs
                                                                       ...-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAL23442.3                                                                CAAAGGAGCCCCTACAGCGTCCTCAAAACCTTCCCCAGCAAGAGGTCCCTGAGCAGAAGGTACGAGAGACCCACCATGGTGGAGATCCCACATCTGGGGGCGCAGCAGCAGCGCACACACTTCCAGCAGCAGCAGCACCATCCGACCTCCATCAGCAACAGCGAGCAACAGCCGCATCACTACCAGCAGGCGCACAGCTCCTATCAGAACGGGCCCAACAGGGCAGCCACGTCCACCTCCCAGTGCCAACAGAGAGGCGGGGGGCCCGCTGGGCATCTGGGCTCCTCCAACAGGTTCTGCCCGCAGCCGGCCGCCGGCCAGAGCCCCCTGGAACTGAGTGCAGAAAGCCGAATGATACTGGATGCGTTTGCCCAGCAATGTAGCCGAGTTCTAAACCTCCTAAATTGTGGGGGGAAACTTCTGGACTCCAAACCTCCACAATCATTGATGTCTTGTATAAAACAGGAGAATAACAGTTACAATGACAGGCCAGACCAGTGCCAGTTAAGTAAAGCGTTCCATTACCAACCTTCAGAGAAAGCAGATGTAGAAATGCAGTTTGTAAAGAAAAAACAGCAGACTTCCGCTTTCTTGCGGGTCTTCACAGATTCACTTCAGAACTATCTTCTAGCCGGTAACTTCCCTGCGCGGAATTCCTCTTTCACTAATGACTATGGACATTTGACTGATATGGACACAATCTCATCCTCTCCAGTACATACAATGGGTGGATGGACATCCCCAGCAACCTCTGAATCACATGGTCATCCGTCTTCCTCCACGCTTCCAGAAGAGGAAGATGACGATGAGGAAGAAGGTTACTGCCCTAGGTGCCAAGAGCTGGAGCAGGAGGTGATCTCTCTGCAGCAAGAAAATGAGGACCTTAGAAGGAAGTTAGAAAGTATACCAGTGCCCTGCCAGACGGTGTTGGATTATTTGAAGACGGTACTTCAACATCATAATCAGTTTCTCATACCACAGCCGGCTGACCAGCCAACAGAGGGCAGCAAGCAGCTGTTGAATAACTACCCTGTCTACATCACCAGCAAACAGTGGGATGAGGCAGTCAACTCTTCGAAGAAGGACGGGCGGCGGCTTCTGCGATACCTCATTAGATTTGTATTCACAACAGATGAGCTTAAATATTCGTGTGGCCTTGGGAAAAGGAAAAGGTCAGTGCAGTCAGGAGACACTGGTCCTGAGAGGCGTCCCCTGGATCCTGTTAAAGTTACATGTCTCAGAGAGTTCATTAGGATGCACTGCACATCAAACCCCGACTGGTGGATGCCTTCAGAAGAACAGATAAACAAAGTGTTCAGTGATGCTGTAGGACATGCGCGCCAAGGTCGTGCTGTGGGCACTTTCTTCCACAATGGAAATTCATATTACGATGGCATAGACCAGCAGGTTTGTCAGGAGGAGGTTTTCAACCGAAGTTCTCTTGATGGATCTGGAGATTGATGTAAGAAGAAGCAAAAAGCACTGTGACGTTTTAACAAGATAAAAAAACATGTTAGCCACAAAAAAATGGAATCAATTAGTGTAATAGTTCAGTCAGTGTGTCTTTAATGTTCTGTCACTGCGGTGGGTGCCTGGAACACAGTGCTGGGAGAAGGCCCTCCGAGCAGTCAAGCCTCTCAAAGAACCCAAAGTATTCTTGGAGCCAGATGTTGTTGTCCGTGTGTCACCTCAGTACTGCACCAGGGACCTGAGCTCTGTTCCGTGACTGTTACGTTCTGTTAGAACTACTGAATAATGCAGCGTTCAGGCCCTGAATCAAGCTAAAGAGAAATGTGTTGGTCTGTTCTGTAGAATTAGCTTTAATAGAATTTGCATTGTACACTATACTATTTAGTTAACTTATGCAAAACCTGAACTTGTTATATATCCTGTGTTCATAAAAACTGTCACCACTACCCA
                                                  Xt7.1-CHK-1008237582                                                                      AGCCCCTACAGCGTCCTCAAAACCTTCCCCAGCAAGAGGTCCCTGAGCAGAAGGTACGAGAGACCCACCATGGTGGAGATCCCACATCTGGGGGCGCAGCAGCAGCGCACACACTTCCAGCAGCAGCAGCACCATCCGACCTCCATCAGCAACAGCGAGCAACAGCCGCATCACTACCAGCAGGCGCACAGCTCCTATCAGAACGGGCCCAACAGGGCAGCCACGTCCACCTCCCAGTGCCAACAGAGAGGCGGGGGGCCCGCTGGGCATCTGGGCTCCTCCAACAGGTTCTGCCCGCAGCCGGCCGCCGGCCAGAGCCCCCTGGAACTGAGTGCAGAAAGCCGAATGATACTGGATGCGTTTGCCCAGCAATGTAGCCGAGTTCTAAACCTCCTAAATTGTGGGGGGAAACTTCTGGACTCCAAACCTCCACAATCATTGATGTCTTGTATAAAACAGGAGAATAACAGTTACAATGACAGGCCAGACCAGTGCCAGTTAAGTAAAGCGTTCCATTACCAACCTTCAGAGAAAGCAGATGTAGAAATGCAGTTTGTAAAGAAAAAACAGCAGACTTCCGCTTTCTTGCGGGTCTTCACAGATTCACTTCAGAACTATCTTCTAGCCGGTAACTTCCCTGCGCGGAATTCCTCTTTCACTAATGACTATGGACATTTGACTGATATGGACACAATCTCATCCTCTCCAGTACATACAATGGGTGGATGGACATCCCCAGCAACCTCTGAATCACATGGTCATCCGTCTTCCTCCACGCTTCCAGAAGAGGAAGATGACGATGAGGAAGAAGGTTACTGCCCTAGGTGCCAAGAGCTGGAGCAGGAGGTGATCTCTCTGCAGCAAGAAAATGAGGACCTTAGAAGGAAGTTAGAAAGTATACCAGTGCCCTGCCAGACGGTGTTGGATTATTTGAAGACGGTACTTCAACATCATAATCAGTTTCTCATACCACAGCCGGCTGACCAGCCAACAGAGGGCAGCAAGCAGCTGTTGAATAACTACCCTGTCTACATCACCAGCAAACAGTGGGATGAGGCAGTCAACTCTTCGAAGAAGGACGGGCGGCGGCTTCTGCGATACCTCATTAGATTTGTATTCACAACAGATGAGCTTAAATATTCGTGTGGCCTTGGGAAAAGGAAAAGGTCAGTGCAGTCAGGAGACACTGGTCCTGAGAGGCGTCCCCTGGATCCTGTTAAAGTTACATGTCTCAGAGAGTTCATTAGGATGCACTGCACATCAAACCCCGACTGGTGGATGCCTTCAGAAGAACAGATAAACAAAGTGTTCAGTGATGCTGTAGGACATGCGCGCCAAGGTCGTGCTGTGGGCACTTTCTTCCACAATGGAAATTCATATTACGATGGCATAGACCAGCAGGTTTGTCAGGAGGAGGTTTTCAACCGAAGTTCTCTTGATGGATCTGGAGATTGATGTAAGAAGAAGCAAAAAGCACTGTGACGTTTTAACAAGATAAAAAAACATGTTAGCCACAAAAAAATGGAATCAATTAGTGTAATAGTTCAGTCAGTGTGTCTTTAATGTTCTGTCACTGCGGTGGGTGCCTGGAACACAGTGCTGGGAGAAGGCCCTCCGAGCAGTCAAGCCTCTCAAAGAACCCAAAGTATTCTTGGAGCCAGATGTTGTTGTCCGTGTGTCACCTCAGTACTGCACCAGGGACCTGAGCTCTGTTCCGTGACTGTTACGTTCTGTTAGAACTACTGAATAATGCAGCGTTCAGGCCCTGAATCAAGCTAAAGAGAAATGTGTTGGTCTGTTCTGTAGAATTAGCTTTAATAGAATTTGCATTGTACACTATACTATTTAGTTAACTTATGCAAAACCTGAACTTGTTATATATCCTGTGTTCATAAAAACTGTCACCACTACCCATATACC
                                                      consensus depths                                                                     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4
                                                                          PREDICTED - Dr ---- 7e-142     XP_695315.1 PREDICTED: hypothetical protein XP_690223 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Gg ==== 0          XP_420730.2 PREDICTED: hypothetical protein [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PREDICTED - Hs ---- 0          XP_001131945.1 PREDICTED: coiled-coil domain containing 4 [Homo sapiens] -------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAL23442.3                                                                                                                                           ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------TGA---------------------------------------ATG------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TGA---ATG------------------------TAA------ATG---------------TAG---TAG---TAATAG---------------------------------------------TGA
                                                                   ORF                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Eye       in                         CCAX9644.b1 GGAGAGATGGAGGAGGAGATGCAGCCGGCAGAGGAGGGGCCCTGCCTCCCAAAAATCTACAAGCAAAGGAGCCCCTACAGCGTCCTCAAAACCTTCCCCAGCAAGAGGTCCCTGAGCAGAAGGTACGAGAGACCCACCATGGTGGAGATCCCACATCTGGGGGCGCAGCAGCAGCGCACACACTTCCAGCAGCAGCAGCACCATCCGACCTCCATCAGCAACAGCGAGCAACAGCCGCATCACTACCAGCAGGCGCACAGCTCCTATCAGAACGGGCCCAACAGGGCAGCCACGTCCACCTCCCAGTGCCAACAGAGAGGCGGGGGGCCCGCTGGGCATCTGGGCTCCTCCAACAGGTTCTGCCCGCAGCCGGCCGCCGGCCAGAGCCCCCTGGAACTGAGTGCAGAAAGCCGAATGATACTGGATGCGTTTGCCCAGCAATGTAGCCGAGTTCTAAACCTCCTAAATTGTGGGGGGAAACTTCTGGACTCCAAACCTCCACAATCATTGATGTCTTGTATAAAACAGGAGAATAACAGTTACAATGACAGGCCAGACCAGTGCCAGTTAAGTAAAGCGTTCCATTACCAACCTTCAGAGAAAGCAGATGTAGAAATGCAGTTTGTAAAGAAAAAACAGCAGACTTCCGCTTTCTTGCGGGTCTTCACAGATTCACTTCAGAACTATCTTCTAGCCGGTAACTTCCCTGCGCGGAATTCCTCTTTCACTAATGACTATGGACATTTGACTGATATGGACACAATCTCATCCTCTCCAGTACAT
  5   1   2       bld Brn4 PIPE in                        CAAL23442.5p                                                                CAAAGGAGCCCCTACAGCGTCCTCAAAACCTTCCCCAGCAAGAGGTCCCTGAGCAGAAGGTACGAGAGACCCACCATGGTGGAGATCCCACATCTGGGGGCGCAGCAGCAGCGCACACACTTCCAGCAGCAGCAGCACCATCCGACCTCCATCAGCAACAGCGAGCAACAGCCGCATCACTACCAGCAGGCGCACAGCTCCTATCAGAACGGGCCCAGCAGGGCAGCCACGTCCACCTCCCAGTGCCAACAGAGAGGCGGGGGGCCCGCTGGGCATCTGGGCTCCTCCAACAGGTTCTGCCCGCAGCCGGCCGCCGGCCAGAGCCCCCTGGAACTGAGTGCAGAAAGCCGAATGATACTGGATGCGTTTGCCCAGCAATGTAGCCGAGTTCTAAACCTCCTAAATTGTGGGGGGAAACTTCTGGACTCCAAACCTCCACAATCATTGATGTCTTGTATAAAACAGGAGAATAACAGTTACAATGACAGGCCAGACCAGTGCCAGTTAAGTAAAGCGTTCCATTACCAACCTTCAGAGAAAGCAGATGTAGAAATGCAGTTTGTAAAGAAAAAACAGCAGACTTCCGCTTTCTTGCGGGTCTTCACAGATTCACTTCAGAACTATCTTCTAGCCGGTAACTTCCCTGCGCGGAATTCCTCTTTCACTAATGACTATGGACATTTGACTGATATGGACACAATCTCATCCTCTCCAGTACATACAATGGGTGGATGGACATCCCCAGCAACCTCTGAATCACATGGTCATCCGTCTTCCTCCACGCTTCCAGAAGAGGAAGATGACGATGAGGAAGAAGGTTACTGCCCTAGGTGCCAAGAGCTGGAGCAGGAGGTGATCTCTCTGCAGCAGGAAAATGAGGACCTTAAAAGGAAGTTTGAAAAGTATACCAGTGCCCTG
  5   1   2       bld Tad5                                  XZT8286.5p                                                                                                                                                                                                                                                                                                                                  CGGGGGGCCCGCTGGGCATCTGGGCTCCTCCACAGGTTCTGCCCGCAGCCGGCCGCCGGCCAGAGCCCCCTGGAACTGAGTGCAGAAAGCCGAATGATACTGGATGCGTTTGCCCAGCAATGTAGCCGAGTTCTAAACCTCCTAAATTGTGGGGGGAAACTTCTGGACTCCAAACCTCCACAATCATTGATGTCTTGTATAAAACAGGAGAATAACAGTTACAATGACAGGCCAGACCAGTGCCAGTTAAGTAAAGCGTTCCATTACCAACCTTCAGAGAAAGCAGATGTAGAAATGCAGTTTGTAAAGAAAAAACAGCAGACTTCCGCTTTCTTGCGGGTCTTCACAGATTCACTTCAGAACTATCTTCTAGCCGGTAACTTCCCTGCGCGGAATTCCTCTTTCACTAATGACTATGGACATTTGACTGATATGGACACAATCTCATCCTCTCCAGTACATACAATGGGTGGATGGACATCCCCAGCAACCTCTGAATCACATGGTCATCCGTCTTCCTCCACGCTTCCAGAAGAGGAAGATGACGATGAGGAAGAAGGTTACTGCCCTAGGTGCCAAGAGCTGGAGCAGGAGGTGATCTCTCTGCAGCAAGAAAATGAGGACCTTAGAAGGAAGTTAGAAAGTATACCAGTGCCCTGCCAGACGGTGTTGGATTATTTGAAGACGGTACTTCAACATCATAATCAGTTTCTCATACCACAGCCGGCTGACCAGCCAACAGAGGGCAGCAAGCAGCTGTTGAATAACTACCCTGTCTACATCACCAGCAAACAGTGGGATGAGGCAGTCAACTCTT
  5   1   2      seed Te1       in                        CBWN14552.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCAGAACTATCTTCTAGCCGGTAACTTCCCTGCGCGGAATTCCTCTTTCACTAATGACTATGGACATTTGACTGATATGGACACAATCTCATCCTCTCCAGTACATACAATGGGTGGATGGACATCCCCAGCAACCTCTGAATCACATGGTCATCCGTCTTCCTCCACGCTTCCAGAAGAGGAAGATGACGATGAGGAAGAAGGTTACTGCCCTAGGTGCCAAGAGCTGGAGCAGGAGGTGATCTCTCTGCAGCAAGAAAATGAGGACCTTAGAAGGAAGTTAGAAAGTATACCAGTGCCCTGCCAGACGGTGTTGGATTATTTGAAGACGGTACTTCAACATCATAATCAGTTTCTCATACCACAGCCGGCTGACCAGCCAACAGAGGGCAGCAAGCAGCTGTTGAATAACTACCCTGTCTACATCACCAGCAAACAGTGGGATGAGGCAGTCAACTCTTCGAAGAAGGACGGGCGGCGGCTTCTGCGATACCTCATTAGATTTGTATTCACAACAGATGAGCTTAAATATTCGTGTGGCCTTGGGAAAAGGAAAAGGTCAGTGCAGTCAGGAGACACTGGTCCTGAGAGGCGTCCCCTGGATCCTGTTAAAGTTACATGTCTCAGAGAGTTCATTAGGATGCACTGCACATCAAACCCCGACTGGTGGATGCCTTCAGAAGAACAGATAAACAAAGTGTTCAGTGATGCTGTAGGACATGCGCGCCAAGGTCGTGCCGTGGGCACTTTCTTCCACAATGGAAATTCATATTACGATGGCATTG
  5   1   2      skin Ova1      in                         CABE7232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAACAGTGGGATGAGGCAGTCAACTCTTCGAAGAAGGACGGGCGGCGGCTTCTGCGATACCTCATTAGATTTGTATTCACAACAGATGAGCTTAAATATTCGTGTGGCCTTGGGAAAAGGAAAAGGTCAGTGCAGTCAGGAGACACTGGTCCTGAGAGGCGTCCCCTGGATCCTGTTAAAGTTACATGTCTCAGAGAGTTCATTAGGATGCACTGCACATCAAACCCCGACTGGTGGATGCCTTCAGAAGAACAGATAAACAAAGTGTTCAGTGATGCTGTAGGACATGCGCGCCAAGGTCGTGCTGTGGGCACTTTCTTCCACAATGGAAATTCATATTACGATGGCATAGACCAGCAGGTTTGTCAGGAGGAGGTTTTCAACCGAAGTTCTCTTGATGGATCTGGAGATTGATGTAAGAAGAAGCAAAAAGCACTGTGACGTTTTAACAAGATAAAAAAACATGTTAGCCACAAAAAAATGGAATCAATTAGTGTAATAGTTCAGTCAGTGTGTCTTTAATGGTCTGTCACTGCGGTGGGT
  3   1   2       bld Brn4 PIPE in                        CAAL23442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGATGAGCTTAAATATTCGTGTGGCCTGGGAAAAGGAAAAGGTCAGTGCAGTCAGGAGACACTGGTCCTGAGAGGCGTCCCCTGGATCCTGTTAAAGTTACATGTCTCAGAGAGTTCATTAGGATGCACTGCACATCAAACCCCGACTGGTGGATGCCTTCAGAAGAACAGATAAACAAAGTGTTCAGTGATGCTGTAGGACATGCGCGCCAAGGTCGTGCTGTGGGCACTTTCTTCCACAATGGAAATTCATATTACGATGGCATAGACCAGCAGGTTTGTCAGGAGGAGGTTTTCAACCGAAGTTCTCTTGATGGATCTGGAGATTGATGTAAGAAGAAGCAAAAAGCACTGTGACGTTTTAACAAGATAAAAAAACATGTTAGCCACAAAAAAATGGAATCAATTAGTGTAATAGTTCAGTCAGTGTGTCTTTAATGTTCTGTCACTGCGGTGGGTGCCTGGAACACAGTGCTGGGAGAAGGCCCTCCGAGCAGTCAAGCCTCTCAAAGAACCCAAAGTATTCTTGGAGCCAGATGTTGTTGTCCGTGTGTCACCTCAGTACTGCACCAGGGACCTGAGCTCTGTTCCGTGACTGTTACGTTCTGTTAGAACTACTGAATAATGCAGCGTTCAGGCCCTGAATCAAGCTAAAGAGAAATGTGTTGGTCTGTTCTGTAGAATTAGCTTTAATAGAATTTGCATTGTACACTATACTATTTAGTTAACTTATGCAAAACCTGAACTTGTTATATATCCTGTGTTCATAAAAACTGTCACCACTACCCATATNCCGGGT
  3   1   2       bld Te1       in                        CBWN14552.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAGGTCAGTGCAGTCAGGAGACACTGGTCCTGAGAGGCGTCCCCTGGATCCTGTTAAAGTTACATGTCTCAGAGAGTTCATTAGGATGCACTGCACATCAAACCCCGACTGGTGGATGCCTTCAGAAGAACAGATAAACAAAGTGTTCAGTGATGCTGTAGGACATGCGCGCCAAGGTCGTGCCGTGGGCACTTTCTTCCACAATGGAAATTCATATTACGATGGCATTGACCAGCAGGTTTGTCAGGAGGAGGTTTTCAACCGAAGTTCTCTTGATGGATCTGGAGATTGATGTAAGAAGAAGCAAAAAGCACTGTGACGTTTTAACAAGATAAAAAAACATGTTAGCCACAGAAAAAAGGAATCAATTAGTGTAATAGTTCAGTCAGTGTGTCTTTAATGTTCTGTCACTGCAGTGGGTGCCTGGAACACAGTGCTGGGAGAAGGCCCTCCGAGCAGTCAAGCCTCTCAAAGAACCCAAAGTATTCTTGGAGCCAGATGTTGTTGTCCGTGTGTCACCTCAGTACTGCACCAGGGACCTGAGCTCTGTTCCGTGACTGTTACGTTCTGTTAGAACTACTGAATAATGCAGGCGTTCAGGCCCTGAATCAAGCTAAAGAGAAATGTGTTGGTCTGTTCTGTAGAATTAGCTTTAATAGAATTTGCATTGTACACTATACTATTTAGTTAACTTATGCAAACCTGAACTTGTTATATATCCTGTGTTCATAAAAACTGTCACCACTACCCATATACCGAGAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE7232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCGAAGTTCTCTTGATGGATCTGGAGATGNATGTAAGAAGAAGCAAAAAGCACTGTGACGTTTTAACAAGATAAAAAAACATGTTAGCCACAAAAAAATGGAATCAATTAGTGTAATAGTTCAGTCAGTGTGTCTTTAATGTTCTGTCACTGCGGTGGGTGCCTGGAACACAGTGCTGGGAGAAGGCCCTCCGAGCAGTCAAGCCTCTCAAAGAACCCAAAGTATTCTTGGAGCCAGATGTTGTTGTCCGTGTGTCACCTCAGTACTGCACCAGGGACCTGAGCTCTGTTCCGTGACTGTTACGTTCTGTTAGAACTACTGAATAATGCAGCGTTCAGGCCCTGAATCAAGCTAAAGAGAAATGTGTTGGTCTGTTCTGTAGAATTAGCTTTAATAGAATTTGCATTGTACACTATACTATTTAGTTAACTTATGCAAAACCTGAACTTGTTATATATCCTGTGTTCATAAAAACTGTCACCACTACCCAT
  3   1   2       bld Eye       in                         CCAX9644.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCCCTCCGAGCAGTCAAGCCTCTCAAAGAACCCAAAGTATTTTTGGAGCCAGATGTTGTTGTCCGTGTGTCACCTCAGTACTGCACCAGGGACCTGAGCTTTGTTCCGTGACTGTTACGTTTTGTTAGAACTACTGAATAATGCAGCGTTCAGGCCCTGAATCAAGCTAAAGAGAAATGTGTTGGTTTGTTTTGTAGAATTAGCTTTAATAGAATTTGCATTGTACACTATACTATTTAGTTAACTTATGCAAAACCTGAACTTGTTATATATCCTGTGTTCATAAAAACTGTCACCACTACCCATATACCGAGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)