Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012092868 Xt7.1-TTpA031k06.5 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA031k06.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAAACTCCAGCTCCTGCTGATGATGTGGATGTGTATTTTGAGACCTTAGCTGATGATAATGAACATGCACGCTTCCAGAAGGCAAGGTTAGAGGCCAAAAAGAAAGAGGAAAAGAAGAGATTGAAAGAAGATATTGAAAAGAGAAGAGCGGAAGCTGCAGAGAAGCGCCAAAAACTGCCAGAAGATGGTTTAACAGAGGAGAAGAAACCCTTTAAGTGTTTCACACCAAAGGGTTCATCTCTCAAGATTGAAGAACGAGCAGAATTCCTCAACAAGTCTGCGCAAAAGGGTAGTACCAAATCAACGCAGCCCGCAGCACCTGTATCTAAGATTGACAGCAAACTTGAGCAATATACTAGTGCAATTGGGAGCAACAAAGGTGCCAAGCCTGCCAAAACAGCGCCCTCTGACTTGCCCTTGGCAGCTGATGGTGTTCGTAATATAAAGAGCATGTGGGAGAAAGGGAATGTTTTCTCATCGCCAGGTGGAGCTTTGTCACCAAACAAGGAAACGGCAACCATAAAAGTTGGTGTTTCAAGTCGTATTAATGAGTGGCTCACAAAAACACCGGAGACCAACAAAACAACTCCCTCTAAACCTTCTGACTTAAGACCTGGAGATGTATCTGGAAAGCGCAATTTATGGGAGAAACAGCAAGTGGAGAAACCTGGATCGCCAACCAAGATGACAGCTGGAGGAAAGAAATCTGACACAAATGGTCTGAGATTTGAAAAGGAGCCATAGGAATACAAACCCGCTGGACCAACTCAGTTACAATGTGCTAATTCGTCTTTTTTTATATATTTATGTTTACTTACCAAAAATGTGTTTTTTTCATTATACCGAATGAAACCATGTATATTAGCACTGTATTTAATAGCCCCCTTCCCCCAATGAGACTATTTGAGACGATTACTGCATTTGCACAAGACCCTAATTTCTCCTGAGGATCAGGCTGTGAAACAAAAAGTATTTCTACTGATACATTAATGGTTTGTTATAGAGTCGCGAATGCTGCAAATTTAAGGCAGAGTTAGGGCAAGTTAGCATTGCGATACATGTCACTAGAAATATACTGCACTTTAGAGAGTCTATTGAATGATCCATTGTCCAACATTAATATTAACGCCATGAATTCATTTTTATCATTTTATTCAAGAAATTTGAACCACCTTATTTTATGAAT
                                                  Xt7.1-CHK-1008241771                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCAGCTCCTGCTGATGATGTGGATGTGTATTTTGAGACCTTAGCTGATGATAATGAACATGCACGCTTCCAGAAGGCAAGGTTAGAGGCCAAAAAGAAAGAGGAAAAGAAGAGATTGAAAGAAGATATTGAAAAGAGAAGAGCGGAAGCTGCAGAGAAGCGCCAAAAACTGCCAGAAGATGGTTTAACAGAGGAGAAGAAACCCTTTAAGTGTTTCACACCAAAGGGTTCATCTCTCAAGATTGAAGAACGAGCAGAATTCCTCAACAAGTCTGCGCAAAAGGGTAGTACCAAATCAACGCAGCCCGCAGCACCTGTATCTAAGATTGACAGCAAACTTGAGCAATATACTAGTGCAATTGGGAGCAACAAAGGTGCCAAGCCTGCCAAAACAGCGCCCTCTGACTTGCCCTTGGCAGCTGATGGTGTTCGTAATATAAAGAGCATGTGGGAGAAAGGGAATGTTTTCTCATCGCCAGGTGGAGCTTTGTCACCAAACAAGGAAACGGCAACCATAAAAGTTGGTGTTTCAAGTCGTATTAATGAGTGGCTCACAAAAACACCGGAGACCAACAAAACAACTCCCTCTAAACCTTCTGACTTAAGACCTGGAGATGTATCTGGAAAGCGCAATTTATGGGAGAAACAGCAAGTGGAGAAACCTGGATCGCCAACCAAGATGACAGCTGGAGGAAAGAAATCTGACACAAATGGTCTGAGATTTGAAAAGGAGCCATAGGAATACAAACCCGCTGGACCAACTCAGTTACAATGTGCTAATTCGTCTTTTTTTATATATTTATGTTTACTTACCAAAAATGTGTTTTTTTCATTATACCGAATGAAACCATGTATATTAGCACTGTATTTAATAGCCCCCTTCCCCCAATGAGACTATTTGAGACGATTACTGCATTTGCACAAGACCCTAATTTCTCCTGAGGATCAGGCTGTGAAACAAAAAGTATTTCTACTGATACATTAATGGTTTGTTATAGAGTCGCGAATGCTGCAAATTTAAGGCAGAGTTAGGGCAAGTTAGCATTGCGATACATGTCACTAGAAATATACTGCACTTTAGAGAGTCTATTGAATGATCCATTGTCCAACATTAATATTAACGCCATGAATTCATTTTTATCATTTTATTCAAGAAATTTGAACCACCTTATTTTATGAATGATTTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     6     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4
                                               BLH MIN      32      40                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - ?? ---- 5e-013     XP_706564.1 PREDICTED: hypothetical protein XP_701472, partial [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ---- 1e-023     AAI24868.1 Unknown (protein for MGC:154387) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xt ---- 1e-026     AAH88598.1 LOC496868 protein [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PREDICTED - Dr ---- 8e-034     XP_687262.1 PREDICTED: similar to Caldesmon (CDM) [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Mm ---- 6e-083     NP_663550.1 caldesmon 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN --- Hs ---- 5e-083     NP_149131.1 caldesmon 1 isoform 5 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 4e-093     NP_989489.1 caldesmon 1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA031k06.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TAG------------------------------------------------------------------------------------------------------ATG---------------------------------------------TGA------------------------------------------------------------------------------------------TAA---------------------ATG---------TAA------------------TAG------------------TAG---------------TAG---------TGAATG------------------------------TGA------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   1       add Te1       in                         CBWN9100.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAAACTCCAGCTCCTGCTGATGATGTGGATGTGTATTTTGAGACCTTAGCTGATGATAATGAACATGCACGCTTCCAGAAGGCAAGGTTAGAGGCCAAAAAGAAAGAGGAAAAGAAGAGATTGAAAGAAGATATTGAAAAGAGAAGAGCGGAAGCTGCAGAGAAGCGCCAAAAACTGCCAGAAGATGGTTTAACAGAGGAGAAGAAACCCTTTAAGTGTTTCACACCAAAGGGTTCATCTCTCAAGATTGAAGAACGAGCAGAATTCCTCAACAAGTCTGCGCAAAAGGGTAGTACCAAATCAACGCAGCCCGCAGCACCTGTATCTAAGATTGACAGCAAACTTGAGCAATATACTAGTGCAATTGGGAGCAACAAAGGTGCCAAGCCTGCCAAAACAGCGCCCTCTGACTTGCCCTTGGCAGCTGATGGTGTTCGTAATATAAAGAGCATGTGGGAGAAAGGGAATGTTTTCTCATCGCCAGGTGGAGCTTTGTCACCAAACAAGGAAACGGCAACCATCATTAATAACACCACTTGGTTGATGTTTGTGAGATACAGTTGGATATCTGCTGATAGCTCCCAATAAAATATAATTATCTGTTAAAAAAAAAAAAAAA
  3   1   1       add Te1       in                         CBWN9100.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAAACTCCAGCTCCTGCTGATGATGTGGATGTGTATTTTGAGACCTTAGCTGATGATAATGAACATGCACGCTTCCAGAAGGCAAGGTTAGAGGCCAAAAAGAAAGAGGAAAAGAAGAGATTGAAAGAAGATATTGAAAAGAGAAGAGCGGAAGCTGCAGAGAAGCGCCAAAAACTGCCAGAAGATGGTTTAACAGAGGAGAAGAAACCCTTTAAGTGTTTCACACCAAAGGGTTCATCTCTCAAGATTGAAGAACGAGCAGAATTCCTCAACAAGTCTGCGCAAAAGGGTAGTACCAAATCAACGCAGCCCGCAGCACCTGTATCTAAGATTGACAGCAAACTTGAGCAATATACTAGTGCAATTGGGAGCAACAAAGGTGCCAAGCCTGCCAAAACAGCGCCCTCTGACTTGCCCTTGGCAGCTGATGGTGTTCGTAATATAAAGAGCATGTGGGAGAAAGGGAATGTTTTCTCATCGCCAGGTGGAGCTTTGTCACCAAACAAGGAAACGGCAACCATCATTAATAACACCACTTGGTTGATGTTTGTGAGATACAGTTGGATATCTGCTGATAGCTCCCAATAAAATATAATTATCTGTAAAAAAAAAAAAAAA
  5   1   2      seed TpA       out                  TTpA031k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCACCTGTATCTAAGATTGACAGCAGACTTGAGCAATATACTAGTGCAATTGGGAGCAACAAAGGTGCCAAGCCTGCCAAAACAGCGCCCTCTGACTTGCCCTTGGCAGCTGATGGTGTTCGTAATATAAAGAGCATGTGGGAGAAAGGGAATGTTTTCTCATCGCCAGGTGGAGCTTTGTCACCAAACAAGGAAACGGCAACCATAAAAGTTGGTGTTTCAAGTCGTATTAATGAGTGGCTCACAAAAACACCGGAGACCAACAAAACAACTCCCTCTAAACCTTCTGACTTAAGACCTGGAGATGTATCTGGAAAGCGCAATTTATGGGAGAAACAGCAAGTGGAGAAACCTGGATCGCCAACCAAGATGACAGCTGGAGGAAAGAAATCTGACACAAATGGTCTGAGATTTGAAAAGGAGCCATAGGAATACAAACCCGCTGGACCAACTCAGTTACAATGTGCTAATTCGTCTTTTTTTATATATTTATGTTTACTTACCAAAAATGTGTTTTTTTCATTATACCGAATGAAACCATGTATATTAGCACTGTATTTAATAGCCCCCTTCCCCCAATGAGACTATTTGAGACGATTACTGCATTTGCACAAGACCCTAATTTCTCCTGAGGATCAGGCTGTGAAACAAAAAGTATTTCTACTGATACATTAATGGTTTGTTATAGAGTCGCGAATGCTGCAAATTTAAGGCAGAGTTAGGGCAAGTTAGCATTGCGATACATGTCACTAGAAATATACTGCACTTTAGAGAGTCTATTGAATGATCCATTGTCCAACATTAATATTAACGCCATGAATTCATTTTTATCATTTTATTNCAGAAATTTGAACCACCTTATTTTATGAATGATTTG
  5   1   2       bld Brn3      out                        CAAK5569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGTAATATAAAGAGCATGTGGGAGAAAGGGAATGTTTTCTCACCGCCAGGTGGAGCTTTGTCACCAAACAAGGAAACGGCAACCATAAAAGTTGGTGTTTCAAGTCGTATTAATGAGTGGCTCACAAAAACACCGGAGACCAACAAAACAACTCCCTCTAAACCTTCTGACTTAAGACCTGGAGATGTATCTGGAAAGCGCAATTTATGGGAGAAACAGCAAGTGGAGAAACCTGGATCGCCAACCAAGGTGAGAGCATCTCTACTGTTTGTCTGTGTGGGAAATAAAAGAAAAGCAAGCCTTCCATAAGGTTGGCTTTCCCAGACAGGCTACCAAAGTAGCCAAGAGTACTGCAGACTAGCACCATATAAACTGGCTGATATTCAGATCACTTTTACCATGGGGTGATTGCCTTCTATCAGGCATCATTGTTGGAGAGGCCACTCAGAGACCAATTTACCTGTTTTGCGTTCCCATGTAGCCCAGCATACTAAAATAAAGGTTCAACTCTCCAAGCATAGGGTCTCTACATATGTGAAGACCCTAGCTCTGGATTGAAGGAGCTGAAGAGTTGCTGACTGGTTTTGGGTGGCTGGAATATGATGTCTTGGGTAGAAGGATGACCTAGGTTGTCCCAAATTACAGCGTATTCAGCAACAGAAAGGAGGGCATATCACTGCTTAGTGCTACCCAATGTTTGCTCCAGAActgggtttttccggataaggagtctttctgtaattcggatctctaccttaagtctacntataaaattatttaaacagt
  3   1   2       bld TbA                             TTbA031c16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGAAACGGCAACCATAAAAGTTGGTGTTTCAAGTCGTATTAATGAGTGGCTCACAAAAACACCGGAGACCAACAAAACAACTCCCTCTAAACCTTCTGACTTAAGACCTGGAGATGTATCTGGAAAGCGCAATTTATGGGAGAAACAGCAAGTGGAGAAACCTGGATCGCCAACCAAGATGACAGCTGGAGGAAAGAAATCTGACACAAATGGTCTGAGATTTGAAAAGGAGCCATAGGAATACAAACCCGCTGGACCAACTCAGTTACAATGTGCTAATTCGTCTTTTTTTATATATTTATGTTTACTTACCAAAAATGTGTTTTTTTCATTATACCGAATGAAACCATGTATATTAGCACTGTATTTAATAGCCCCCTTCCCCCAATGAGACTATTTGAGACGATTACTGCATTTGCACAAGACCCTAATTTCTCCTGAGGATCAGGCTGTGAAACAAAAAGTATTTCTACTGATACATTAATGGTTTGTTATAGAGTCGCGAATGCTGCAAATTTAAGGCAGAGTTAGGGCAAGTTAGCATTGCGATACATGTCACTAGAAATATACTGCACTTTAGAGAGTCTATTGAATGATCCATTGTCCAACATTAATATTAACGCCATGAATTCATTTTTATCATTTTATTCAAGAAATTTGAACCACCTTATTTTAGAATGATTTGCCCAAATTGGCTTTTATTAGCTTACCGTGGTACTATGAAATAATCTTAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA  5x3  out                   TTpA031k08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACTTCTGACTTAAGACCTGGAGATGTATCTGGAAAGCGCAATTTATGGGAGAAACAGCAAGTGGAGAAACCTGGATCGCCAACCAAGATGACAGCTGGAGGAAAGAAATCTGACACAAATGGTCTGAGATTTGAAAAGGAGCCATAGGAATACAAACCCGCTGGACCAACTCAGTTACAATGTGCTAATTCGTCTTTTTTTATATATTTATGTTTACTTACCAAAAATGTGTTTTTTTCATTATACCGAATGAAACCATGTATATTAGCACTGTATTTAATAGCCCCCTTCCCCCAATGAGACTATTTGAGACGATTACTGCATTTGCACAAGACCCTAATTTCTCCTGAGGATCAGGCTGTGAAACAAAAAGTATTTCTACTGATACATTAATGGTTTGTTATAGAGTCGCGAATGCTGCAAATTTAAGGCAGAGTTAGGGCAAGTTAGCATTGCGATACATGTCACTAGAAATATACTGCACTTTAGAGAGTCTATTGAATGATCCATTGTCCAACATTAATATTAACGCCATGAATTCATTTTTATCATTTTATTCAAGAAATTTGAACCACCTTATTTTATGAATGATTTGCCCAAATTGGCTTTTATTAGCTTACCGTGGTACTATGAAATATTTAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)