Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAR2795.3                            3 END     3         100      100                estrogen receptor alpha [Silurana tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012092986 Xt7.1-CABI4583.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABI4583.5 GTGGACAGCCATGTCACATTTTCTTTGCCAGTAGCTATGACCATGCCCCTACACAACAAAACCACTGGAGTTACCCTGTTGCATCAGATTCAGTCATCAGAACTGGAGACCTTAAGCAGACCACCTCTGAAGATACCACTCGAAAGACCACTCAGTGAAATGTATGTGGAAAATAACAGGACGGGCATTTTCAACTACCCCGAGGGCACGACTTATGACTTTGCTGCTGCTGCTGCACCGGTGTATAGCTCTGCTAGTCTCAGCTATGCTGCCAGCTCAGAGACATTCGGATCTAGCAGTCTGACTGGGCTACATACTTTGAACAATGTGCCTCCAAGTCCTGTAGTGTTCCTTCAAACTCCACAGCTATCACCGTTTATCCACCACCATGGCCAACAAGTGCCATACTATTTGGAGAGTGAACAGGGAACTTTCGCAGTAAGGGAAGCAGCACCCCCAACATTTTACAGGTCAAGTTCAGACAACAGAAGGCAGAGTGGAAGGGAACGCATGACATCAGCTAATGATAAGGGCCCTCCATCCATGGAATCTACCAAGGAAACACGATATTGTGCTGTTTGCAGTGACTATGCATCTGGGTACCATTATGGCGTCTGGTCCTGTGAAGGTTGCAAAGCTTTTTTTAAAAGAAGCATACAAGGACATAATGACTATATGTGCCCTGCAACCAATCAGTGCACCATAGACAAGAACAGAAGAAAAAGCTGCCAAGCCTGCCGACTGAGAAAATGCTATGAAGTGGGCATGATGAAAGGGGGTATTCGAAAGGATCGCAGGGGAGGACGTATGTTGAAACATAAGCGGCAGAAAGAAGAACAAGAGCAGAAAAATGATGTGACTCCATCAGAGATTAGGACAACGTCCATCTGGGTGAATCCTTCAGTGAAAAGCATGAAGCTGAGCCCAGTACTGTCGCTTACAGCTGAGCAGCTTATCAGTGCCTTGATGGAG
                                                  Xt7.1-CHK-1008250561       AGCCATGTCACATTTTCTTTGCCAGTAGCTATGACCATGCCCCTACACAACAAAACCACTGGAGTTACCCTGTTGCATCAGATTCAGTCATCAGAACTGGAGACCTTAAGCAGACCACCTCTGAAGATACCACTCGAAAGACCACTCAGTGAAATGTATGTGGAAAATAACAGGACGGGCATTTTCAACTACCCCGAGGGCACGACTTATGACTTTGCTGCTGCTGCTGCACCGGTGTATAGCTCTGCTAGTCTCAGCTATGCTGCCAGCTCAGAGACATTCGGATCTAGCAGTCTGACTGGGCTACATACTTTGAACAATGTGCCTCCAAGTCCTGTAGTGTTCCTTCAAACTCCACAGCTATCACCGTTTATCCACCACCATGGCCAACAAGTGCCATACTATTTGGAGAGTGAACAGGGAACTTTCGCAGTAAGGGAAGCAGCACCCCCAACATTTTACAGGTCAAGTTCAGACAACAGAAGGCAGAGTGGAAGGGAACGCATGACATCAGCTAATGATAAGGGCCCTCCATCCATGGAATCTACCAAGGAAACACGATATTGTGCTGTTTGCAGTGACTATGCATCTGGGTACCATTATGGCGTCTGGTCCTGTGAAGGTTGCAAAGCTTTTTTTAAAAGAAGCATACAAGGACATAATGACTATATGTGCCCTGCAACCAATCAGTGCACCATAGACAAGAACAGAAGAAAAAGCTGCCAAGCCTGCCGACTGAGAAAATGCTATGAAGTGGGCATGATGAAAGGGGGTATTCGAAAGGATCGCAGGGGAGGACGTATGTTGAAACATAAGCGGCAGAAAGAAGAACAAGAGCAGAAAAATGATGTGACTCCATCAGAGATTAGGACAACGTCCATCTGGGTGAATCCTTCAGTGAAAAGCATGAAGCTGAGCCCAGTACTGTCGCTTACAGCTGAGCAGCTTATCAGTGCCTTG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                               BLH ATG      36     288 
                                               BLH MIN      36     133 
                                               BLH MPR      36     133 
                                               BLH OVR      36     266 
                                               ORF LNG      36      13 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Br ==== 3e-011     AAB68691.1 RAR [Branchiostoma lanceolatum] ======================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 4e-023     NP_001024953.1 Nuclear Hormone Receptor family member (nhr-91) [Caenorhabditis elegans] -------------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 7e-024     XP_784483.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 2e-028     NP_729340.1 estrogen-related receptor CG7404-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bf ---- 2e-032     AAU88063.1 estrogen receptor-related receptor short isoform [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN --- Ci ---- 4e-032     BAE06416.1 nuclear receptor [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                  PROTEIN --- Dr ---- 1e-057     NP_694491.1 estrogen receptor 1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Hs ==== 4e-121     NP_000116.2 estrogen receptor 1 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Mm ==== 3e-122     NP_031982.1 estrogen receptor 1 (alpha) [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Gg ==== 8e-143     NP_990514.1 estrogen receptor, alpha [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Xl ==== 5e-179     AAQ84782.1 estrogen receptor alpha 1 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === ?? ==== 5e-179     NP_001083086.1 estrogen receptor alpha 1 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Xt ==== 0          BAE81788.1 estrogen receptor alpha [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABI4583.5                                     ATG---ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATGATG------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG
                                                                   ORF                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2   10  bld Ovi1 5g3  out                        CABI5140.5p GTGGACAGCCATGTCACATTTTCTTTGCCAGTAGCTATGACCATGCCCCTACACAACAAAACCACTGGAGTTACCCTGTTGCATCAGATTCAGTCATCAGAACTGGAGACCTTAAGCAGACCACCTCTGAAGATACCACTCGAAAGACCACTCAGTGAAATGTATGTGGAAAATAACAGGACGGGCATTTTCAACTACCCCGAGGGCACGACTTATGACTTTGCTGCTGCTGCTGCACCGGTGTATAGCTCTGCTAGTCTCAGCTATGCTGCCAGCTCAGAGACATTCGGATCTAGCAGTCTGACTGGGCTACATACTTTGAACAATGTGCCTCCAAGTCCTGTAGTGTTCCTTCAAACTCCACAGCTATCACCGTTTATCCACCACCATGGCCAACAAGTGCCATACTATTTGGAGAGTGAACAGGGAACTTTCGCAGTAAGGGAAGCAGCACCCCCAACATTTTACAGGTCAAGTTCAGACAACAGAAGGCAGAGTGGAAGGGAACGCATGACATCAGCTAATGATAAGGGCCCTCCATCCATGGAATCTACCAAGGAAACACGATATTGTGCTGTTTGCAGTGACTATGCATCTGGGTACCATTATGGCGTCTGGTCCTGTGAAGGTTGCAAAGCTTTTTTTAAAAGAAGCATACAAGGACATAATGACTATATGTGCCCTGCAACCAATCAGTGCACCATAGACAAGAACAGAAGAAAAAGCTGCCAAGCCTGCCGACTGAGAAAATGCTATGAAGTGGGCATGATGAAAGGGGGTATT
  5   1   2      seed Ovi1      out                        CABI4583.5p                                                                                                                                TGAAGATACCACTCGAAAGACCACTCAGTGAAATGTATGTGGAAAATAACAGGACGGGCATTTTCAACTACCCCGAGGGCACGACTTATGACTTTGCTGCTGCTGCTGCACCGGTGTATAGCTCTGCTAGTCTCAGCTATGCTGCCAGCTCAGAGACATTCGGATCTAGCAGTCTGACTGGGCTACATACTTTGAACAATGTGCCTCCAAGTCCTGTAGTGTTCCTTCAAACTCCACAGCTATCACCGTTTATCCACCACCATGGCCAACAAGTGCCATACTATTTGGAGAGTGAACAGGGAACTTTCGCAGTAAGGGAAGCAGCACCCCCAACATTTTACAGGTCAAGTTCAGACAACAGAAGGCAGAGTGGAAGGGAACGCATGACATCAGCTAATGATAAGGGCCCTCCATCCATGGAATCTACCAAGGAAACACGATATTGTGCTGTTTGCAGTGACTATGCATCTGGGTACCATTATGGCGTCTGGTCCTGTGAAGGTTGCAAAGCTTTTTTTAAAAGAAGCATACAAGGACATAATGACTATATGTGCCCTGCAACCAATCAGTGCACCATAGACAAGAACAGAAGAAAAAGCTGCCAAGCCTGCCGACTGAGAAAATGCTATGAAGTGGGCATGATGAAAGGGGGTATTCGAAAGGATCGCAGGGGAGGACGTATGTTGAAACATAAGCGGCAGAAAGAAGAACAAGAGCAGAAAAATGATGTGACTCCATCAGAGATTAGGACAACGTCCATCTGGGTGAATCCTTCAGTGAAAAGCATGAAGCTGAGCCCAGTACTGTCGCTTACAGCTGAGCAGCTTATCAGTGCCTTGATGGAGGCGG
  5   1   2       bld Liv1      out                        CAAR2795.5p                                                                                                                                                   ACCACTCAGTGAAATGTATGCGGAAAATAACAGGACGGGCATTTTCAACTACCCCGAGGGCACGACTTATGACTTTGCTGCTGCTGCTGCACCGGTGTATAGCTCTGCTAGTCTCAGCTATGCTGCCAGCTCAGAGACATTCGGATCTAGCAGTCTGACTGGGCTACATACTTTGAACAATGTGCCTCCAAGTCCTGTAGTGTTCCTTCAAACTCCACAGCTATCACCGTTTATCCACCACCATGGCCAACAAGTGCCATACTATTTGGAGAGTGAACAGGGAACTTTCGCAGTAAGGGAAGCAGCACCCCCAACATTTTACAGGTCAAGTTCAGACAACAGAAGGCAGAGTGGAAGGGAACGCATGACATCAGCTAATGATAAGGGCCCTCCATCCATGGAATCTACCAAGGAAACACGATATTGTGCTGTTTGCAGTGACTATGCATCTGGGTACCATTATGGCGTCTGGTCCTGTGAAGGTTGCAAAGCTTTTTTTAAAAGAAGCATACAAGGACATAATGACTATATGTGCCCTGCAACCAATCAGTGCACCATAGACAAGAACAGAAGAAAAAGCTGCCAAGCCTGCCGACTGAGAAAATGCTATGAAGTGGGCATGATGAAAGGGGGTATTCGAAAGGATCGCAGGGGAGGACGTATGTTGAAACATAAGCGGCAGAAAGAAGAACAAGAGCAGAAAAATGATGTGACTCCATCAGAGATTAGGACAACATCCATCTGGGTGAATCCTTCAGTGAAAAGCATGAAGCTGAGCCCAGTACTGTCGCTTACAGCTGAGCAGCTTATCAGTGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)