Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT30971.5                            3 END     1          12       33                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012093285 Xt7.1-XZG43377.5 - 8 ESTs
                                                                       ...-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG43377.5                                                                          GCATCACCGCACTTCAGTCTCAAGTTCCCCAGCTTGTTGGCGTTCCATTCCATGCCAGCGTTCTGAACTTCGACTGGACTATGTGCTGGCTTGTGGACAGACTTTCCGGTGGAAGGAATTTAGCCCAGGCTACTGGACTGGAGTCTTAAAAGGGCGGGTGTGGACTCTGACTCAGACAGATGAGCATATCTGGTACACTGTGTATACCAACGACCAAAGACCTGCACAGGATTCTGATGAGTCGAAAGTCACTACAGAGCAAAATGATAGGCAACATAGCGCTAAGCCATGTAAATTGCCGAAAAAAAAAGATAAAAAAGGAAGAAATAAACCCAGAAGATAAAGCGATAACTGGAGATTGTCCGCTCATTTGTAAAGATACAGACTGCAAGAAAGACCAAGAGATACTGGAAGACTACTTCCAACTCAACATCAGTCTGAGGACACTCTACCAGCATTGGGAGAGCTCAGACCCAAACTTCCAGAGAGTCGCACAGGATTTTCCAGGTATTCGAATTTTACGCCAGGACCCCACAGAATGCCTCTTCTCATTTATTTGCACCTCTAATAATAACATCTCTCGCATCACGGGTATGATCGAGCGAGTGTGCTGCTCTCTGGGACAGCGTTTGTGCCAGCTGGACTCTGACGTGTACCACACCTTCCCAACTTTACAGGAATTGGCAGCGGAAGGCACAGAGGCCAAGTTGAGGGATTTGGGCTTCGGGTACAGAGCCAGGTTTGTCAGTGAAAGTGCAAGAACCATCTTATCCAAACATTGCCCTGACTGGTTGGAGAGTTTGCGTCTTGTACCCTATGAAGAGGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTAGGAGCTAAGGTGGCAGACTGCGTTTGCCTAATGGCCTTGGATAAGCCAGAAGCTGTGCCTGTTGACACCCATGTTTGGCAAGTAGCAAAGAGAGACTACTTGCCCCAGCTTGGTAGTGGCAACAAGACACTGACAGATCGAGTGTACAGGGAGACAGGAGATTTTTTCCATAATTTGTGGGGACCCTATGCTGGATGGGCGCAGTCGGTCTTGTTCTGCTCTGAGCTCAAGAAATTTCACGATTCCACAAATCACATCAAACCAAAGGTGAACCGGAAAACTC
                                                  Xt7.1-CHK-1008237816                                                                                CCGCACTTCAGTCTCAAGTTCCCCAGCTTGTTGGCGTTCCATTCCATGCCAGCGTTCTGAACTTCGACTGGACTATGTGCTGGCTTGTGGACAGACTTTCCGGTGGAAGGAATTTAGCCCAGGCTACTGGACTGGAGTCTTAAAAGGGCGGGTGTGGACTCTGACTCAGACAGATGAGCATATCTGGTACACTGTGTATACCAACGACCAAAGACCTGCACAGGATTCTGATGAGTCGAAAGTCACTACAGAGCAAAATGATAGGCAACATAGCGCTAAGCCATGTAAATTGCCGAAAAAAAAAGATAAAAAAGGAAGAAATAAACCCAGAAGATAAAGCGATAACTGGAGATTGTCCGCTCATTTGTAAAGATACAGACTGCAAGAAAGACCAAGAGATACTGGAAGACTACTTCCAACTCAACATCAGTCTGAGGACACTCTACCAGCATTGGGAGAGCTCAGACCCAAACTTCCAGAGAGTCGCACAGGATTTTCCAGGTATTCGAATTTTACGCCAGGACCCCACAGAATGCCTCTTCTCATTTATTTGCACCTCTAATAATAACATCTCTCGCATCACGGGTATGATCGAGCGAGTGTGCTGCTCTCTGGGACAGCGTTTGTGCCAGCTGGACTCTGACGTGTACCACACCTTCCCAACTTTACAGGAATTGGCAGCGGAAGGCACAGAGGCCAAGTTGAGGGATTTGGGCTTCGGGTACAGAGCCAGGTTTGTCAGTGAAAGTGCAAGAACCATCTTATCCAAACATTGCCCTGACTGGTTGGAGAGTTTGCGTCTTGTACCCTATGAAGAGGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTAGGAGCTAAGGTGGCAGACTGCGTTTGCCTAATGGCCTTGGATAAGCCAGAAGCTGTGCCTGTTGACACCCATGTTTGGCAAGTAGCAAAGAGAGACTACTTGCCCCAGCTTGGTAGTGGCAACAAGACACTGACAGATCGAGTGTACAGGGAGACAGGAGATTTTTTCCATAATTTGTGGGGACCCTATGCTGGATGGGCGCAGTCGGTCTTGTTCTGCTCTGAGCTCAAGAAATTTCACGATTCCACAAATCACATCAAACCAAAGGTGAACCGGAAAACTCAAAAGA
                                                      consensus depths                                                                               2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     3     5     3     5     3     5     3     5     3     4     3     4
                                               BLH MIN     278      77                                                                          
                                               BLH OVR     179      87                                                                          
                                               ORF LNG     179      14                                                                          
                                                                                                                                                                                                                                                                                                              PROTEIN --- Sc ---- 2e-046     NP_013651.1 Excises 7,8-dihydro-8-oxoguanine (8-OxoG) when 8-OxoG is oppposite cytosine orthymine (but not adenine); Ogg1p [Saccharomyces cerevisiae] --------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 7e-051     NP_572499.2 CG1795-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PREDICTED - Sp ---- 1e-072     XP_791749.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 5e-074     XP_001234323.1 PREDICTED: similar to 8-oxoguanine DNA glycosylase [Gallus gallus] -------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 3e-075     NP_002533.1 8-oxoguanine DNA glycosylase isoform 1a; 8-hydroxyguanine DNA glycosylase [Homosapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 1e-104     NP_035087.2 8-oxoguanine DNA-glycosylase 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Xl ---- 0          AAH97662.1 LOC733253 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG43377.5                                                                                                                                                          ATG---------------------------------------------------------------TAA------------------TGA---------ATG------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  5   1   2      skin Gas0      in                         dad25d10.y1                                   CCGGGCTCAACTTTTGCTGCAGTTTTCATCCCACAGAATGCATCACCGCACTTCAGTCTCAAGTTCCCCAGCTTGTTGGCGTTCCATTCCATGCCAGCGTTCTGAACTTCGACTGGACTATGTGCTGGCTTGTGGACAGACTTTCCGGTGGAAGGAATTTAGCCCAGGCTACTGGACTGGAGTCTTAAAAGGGCGGGTGTGGACTCTGACTCAGACAGATGAGCATATCTGGTACACTGTGTATACCAACGACCAAAGACCTGCACAGGATTCTGATGAGTCGAAAGTCACTACAGAGCAAAATGATAGGCAACATAGCGCTAAGCCATGTAAATTGCCGAAAAAAAAAGATAAAAAAGGAAGAAATAAACCCAGAAGATAAAGCGATAACTGGAGATTGTCCGCTCATTTGTAAAGATACAGACTGCAAGAAAGACCAAGAGATACTGGAAGACTACTTCCAACTCAACATCAGTCTGAGGACACTCTACCAGCATTGGGAGAGCTCAGACCCAAACTTCCAGAGAGTCGCACAGGATTTTCCAGGTATTCGAATTTTACGCCAGGACCCCACAGAATGCCT
  5   1   2      shim Neu  FLt3                      TNeu001j17.p1kSP6                                      CGGGCCGGGACTTTGCAAGTCCGTGAGAAGACGAGTGCATCACCGCACTTCAGTCTCAAGTTCCCCAGCTTGTTGGCGTTCCATTCCATGCCAGCATTCTGAACTTCGACTGGACTATGTGCTGGCTTGTGGACAGACTTTCCGGTGGAAGGAATTTAGCCCAGGCTACTGGACTGGAGTCTTAAAAGGGCGGGTGTGGACTCTGACTCANACAGATGAGCATATCTGGTACACTGTGTATACCAACGACCAAAGACCTGCACAGGATTCTGATGAGTCGAAAGTCACTACAGAGCAAAATGATAGGCAACATAGCGCTAAGCCATGTAAATTGCCGAAAAAAAAGATAAAAAAGGAAGAAATAAACCCAGAAGATAAAGCGATAACTGGAGATTGTCCGCTCATTTGTAAAGATACAGACTGCAAGAAAGACCAAGAGATACTGGAAGACTACTTCCAACTCAACATCAGTCTGAGGACACTCTACCAGCATTGGGAGAGCT
  5   1   2      seed Gas7      in                         XZG43377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                   CGATAACTGGAGCTTGTCCGCTCATTTGTAAAGATACAGACTGCAAGAAAGACCAAGAGATACTGGAAGACTACTTCCAACTCAACATCAGTCTGAGGACACTCTACCAGCATTGGGAGAGCTCAGACCCAAACTTCCAGAGAGTCGCACAGGATTTTCCAGGTATTCGAATTTTACGCCAGGACCCCACAGAATGCCTCTTCTCATTTATTTGCACCTCTAATAATAACATCTCTCGCATCACGGGTATGATCGAGCGAGTGTGCTGCTCTCTGGGACAGCGTTTGTGCCAGCTGGACTCTGACGTGTACCACACCTTCCCAACTTTACAGGAATTGGCAGCGGAAGGCACAGAGGCCAAGTTGAGGGATTTGGGCTTCGGGTACAGAGCCAGGTTTGTCAGTGAAAGTGCAAGAACCATCTTATCCAAACATTGCCCTGACTGGTTGGAGAGTTTGCGTCTTGTACCCTATGAAGAGGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTAGGAGCTAAGGTGGCAGACTGCGTTTGCCTAATGGCCTTGGATAAGCCAGAAGCTGTGCCTGTTGACACCCATGTTTGGCAAGTAGCAAAGAGAGACTACTTGCCCCAGCTTGGTAGTGGCAACAAGACACTGACAGATCGAGTGTACAGGGAGACAGGAGATTTTTTCCATAATTTGTGGGGACCCTATGCTGGATGGGCGCAGTCGGTACGTGGCCAGTGATTTATATGTATTTATGTTCTAAATTACTTTCTCTACTGAAGT
  3   1   2       bld Gas0      in                         dad25d10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTGCACCTCTAATAATAACATCTCTCGCATCACGGGTATGATCGAGCGAGTGTGATGCTCTATGGGACAGCGTTTGTGCCAGATGGAATCTGACGTGTACCACACCTTCCCAACTTTACAGGAATTGGCAGCGGAAGGCACAGAGGCCAAGTTGAGGGATTTGGGCTTCGGGTACAGAGCCAGGTTTGTCAGTGAAAGTGCAAGAACCATCTTATCCAAACATTGCCCTGACTGGTTGGAGAGTTTGCGTCTTGTACCCTATGAAGAGGCAAAGAATGCACTGTGCTCCCTGCCAGGGGTAGGAGATAAGGTGGCAGACTGCGTTTGCCTAATGGCCTTGGATAAGCCAGAAGCTGTGCCTGTTGACACCCATGTTTGGCAAGTAGCAAAGAGAGACTACTTGCCCCAGATTGGTAGTGGCAACAAGACACTGACAGATCGAGTGTACAGGGAGACAGGAGATTTTTTCCATAATTTGTGGGGACCCTATGCTGGATGGGCGCAGTCGGTCTTGTTATGCTATGAGCTCAAGAAATTTCACGATTCCACAAATCACATCAAACCAAAGGTGAACCGGAAAACTCAAAAAAAA
  5   1   2       bld In63                            IMAGE:8961891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAAAGGGATATTTATAAAAATAAAATCGTTTTGGGGGATATAGTGCCCGAAAATATTACCCCACCTGTCAAAGAGTTACTGTAAGATGTCGAGTATATTAAGGGCCATTGGTTTATATCTTGTAGCGGAAGGCACAGAGGCCAAGTTGAGGGATTTGGGCTTCGGGTACAGAGCCAGGTTTGTCAGTGAAAGTGCAAGAACCATCTTATCCAAACATTGCCCTGACTGGTTGGAGAGTTTGCGTCTTGTACCCTATGAAGAGGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTAGGAGCTAAGGTGGCAGACTGCGTTTGCCTAATGGCCTTGGATAAGCCAGAAGCTGTGCCTGTTGACACTTTTTTTTGGCAAGTAGCAAAGAGAGACTACTTGCCCCAGCTTGGTAGTGGCAACAAGACACTGACAGATCGAGTGTACAGGGAGACAGGAGATTTTTTCCATAATTTGTGGGGACCCTATGCTGGATGGGCGCAGTCGGTCTTGTTCTGCTCTGAGCTCAAGAAATTTCACGATTCCACAAATCACATCAAACCAAAGGTGAACCGGAAAACTCAAAAGAAAGAAAAAAACAGCAAGTTCTGTATGAATTATACATTGGCATTTCGTTTTTTACAAACAAATTGTATATTGATATTTTTTAGTATTTTTATATAAAATGTGTTCAATGAATTATTACGCTACATTACAACTTGTTGTTGTTTAAAGGGGAGTGCAGCTGGGCGTGATCACCTGTGTGGCAATAGCTTGTAATAGGCACAGGTTTTACCTCCAACTTTTCTTCCACTTTGTACCTCGGGCCCTCATGCTTGTCCACACGAAACGAATAAGAATCGGTACGGGGACTTTTACTGGTACTTGCGCGCCCTGTTAAGCAGTTTTAGACTTCT
  5   1   2       bld Neu       out                  TNeu056f12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCACACCTTCCCAACTTTACAGGAATTGGCAGCGGAAGGCACAGAGGCCAAGTTGAGGGATTTGGGCTTCGGGTACAGAGCCAGGTTTGTCAGTGAAAGTGCAAGAACCATCTTATCCAAACATTGCCCTGACTGGTTGGAGAGTTTGCGTCTTGTACCCTATGAAGAGGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTAGGAGCTAAGGTGGCAGACTGCGTTTGCCTAATGGCCTTGGATAAGCCAGAAGCTGTGCCTGTTGACACCCATGTTTGGCAAGTAGCAAAGAGAGACTACTTGCCCCAGCTTGGTAGTGGCAACAAGACACTGACAGATCGAGTGTACAGGGAGACAGGAGATTTTTTCCATAATTTGTGGGGACCCTATGCTGGATGGGCGCAGTCGGTCTTGTTCTGCTCTGAGCTCAAGAAATTTCACGATTCCACAAATCACATCAAACCAAAGGTGAACCGGAAAACTCAAAAGAAGAAAAAAACAGCAAGTTCTGTATGAATTATACATTGGCATTCGTTTTTTACAAACAAATTGTATATTGATATTTTTTAGTATTTTTATATAAAATGTGTTCAAATGAATTATACGCTAACATTACAACTT
  3   1   2       bld Gas7      in                         XZG43377.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACACCCATGTTTGGCAAGTAGCAAAGAGAGACTACTTGCCCCAGCTTGGTAGTGGCAACAAGACACTGACAGATCGAGTGTACAGGGAGACAGGAGATTTTTTCCATAATTTGTGGGGACCCTATGCTGGATGGGCGCAGTCGGTACGTGGCCAGTGATTTATATGTATTTATGTTCTAAATTACTTTCTCTACTGAAGTTAAATTAATTATCATCCATCATCTTCAGGGAAATAGTGCCCCTAGTGGTCAAAAATACATGAAATGTTTAAAGGCTCCACCTTGCTATAATGTTTGATCAAAGCATTTCATGAGAGTACTGGTAGAGAAGATTAGCCCTACAAAGGCAGGTTAATGATGACTTGTAAATATTACATTCATTGGTTTCTGTGGTCAGAAAAGGGTATTATCTGGATTGCTTTCTCCATTAATAATAAAGATTCATATATGGCACTAATACAGTATGTGCATGAAATCTTTCTCAGCAGACAGAGGGGGTGAGGGCTGCCTGTTGTCTGCACATTGCTCATTAGCACTTTAGAAGGCTATAATCTGGAACAGTTAGAAATAGCAAAACTGATGTGTGCAAGGATTTCTTTTATTTCTTTCTTAGGCATATGCTTTCATTTTCTATACTCACAAGTCGTTAAAGCTGAAAACCACCATAGCATTCATGTACTTTTCGTTCTTCTCTAGAAAAGCTTTGATGTTGTTTTAGAAATAAAAAGCTACCCCAAGGGCGCTCTGCAGGGGTATAATTATAGGAGATGCGGAGCAACTTGCACAAGAGGGGCCCATGTTCTTAAATATTATTTTCACTACAGCAGTTAAAAAAAAAAAAAAAGG
  5   1   2       bld TbA                            TTbA014d21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAGCAAAGAGAGACTACTGGCCCCAGCTTGGGTAGTGGGCAACAAGAACACTGGACAGAATTCGAGTGGTACAGGGGAGAACAGGGAGAATTTTTTTCCATAATTTTGTGGGGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)