Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 204.0    0Xt7.1-CABI6858.3                           49 PI      80        197      462                AP-2 repressor [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012093567 Xt7.1-CBXT2926.5 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBXT2926.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTATGAAAAACCACCACCTCTAATGAAAACCATAAAAATTGAGCCTGGGCTGGAACAACAAAACCCAGAATTCTACCCAGAACAGTTATCACCTGGAATCAGCACACCACCCAAGGGGATGAATTACGAAAATCACCCTTCGGTTATAGTGCACCCAGGAAAGAGACCTTTGCCAGTGGAATCCCCCGAAACTCAAAGGAAAAGGCGGATACACCGATGTGATTATGAAGGTTGCAACAAAGTTTACACCAAAAGTTCCCATTTAAAGGCACACAGAAGGACACATACAGGGGAAAAGCCTTATCAGTGTACTTGGGAAGGATGCACATGGAAGTTTGCCCGCTCTGATGAACTGACTCGACATTTCCGTAAACACACTGGAATCAAACCATTTCAGTGCCCAGACTGTGACCGCAGCTTTTCCCGCTCGGACCATCTTGCTCTTCACAGAAAGAGACACATGCTTGTCTAAATGCCCTTCTTGCCTTTTATACGCAAAAATATTATTTTTGGATTCAGCTGGTTCTGAATCTACATAATTTTTTTTCCATATGGTCAGTAAATGAGGTCCCCCATGCTTCATTGTACTAACCACGGGTCAGACCTAAGAATGTGAACATTTTCCTACAGAGTCAATGCAGTACCTTCCTGCACACAGTACACCTCAGGAAATACCCCAATGGACAATGTACTGCTTTCTATGTACTTACAAGCCATATTATCTATATTGAATAAGTTATAAATGTATTTAATTATCAACACAATTTGCCTATTTGCTTCATCTTGCCACAACATTCCTCACATAAGTTTATTTTTTTTGTCCACAACTAAAGATATACATTTCCCAAAGTAGCCACGTAACGGTGTAAGAATTGTTTCCATGTTACTAATTTATGCTGTAGAATAGTGAATTTAAACATGCACAGCACTTTTCAG
                                                  Xt7.1-CHK-1008243809                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAACCACCACCTCTAATGAAAACCATAAAAATTGAGCCTGGGCTGGAACAACAAAACCCAGAATTCTACCCAGAACAGTTATCACCTGGAATCAGCACACCACCCAAGGGGATGAATTACGAAAATCACCCTTCGGTTATAGTGCACCCAGGAAAGAGACCTTTGCCAGTGGAATCCCCCGAAACTCAAAGGAAAAGGCGGATACACCGATGTGATTATGAAGGTTGCAACAAAGTTTACACCAAAAGTTCCCATTTAAAGGCACACAGAAGGACACATACAGGGGAAAAGCCTTATCAGTGTACTTGGGAAGGATGCACATGGAAGTTTGCCCGCTCTGATGAACTGACTCGACATTTCCGTAAACACACTGGAATCAAACCATTTCAGTGCCCAGACTGTGACCGCAGCTTTTCCCGCTCGGACCATCTTGCTCTTCACAGAAAGAGACACATGCTTGTCTAAATGCCCTTCTTGCCTTTTATACGCAAAAATATTATTTTTGGATTCAGCTGGTTCTGAATCTACATAATTTTTTTTCCATATGGTCAGTAAATGAGGTCCCCCATGCTTCATTGTACTAACCACGGGTCAGACCTAAGAATGTGAACATTTTCCTACAGAGTCAATGCAGTACCTTCCTGCACACAGTACACCTCAGGAAATACCCCAATGGACAATGTACTGCTTTCTATGTACTTACAAGCCATATTATCTATATTGAATAAGTTATAAATGTATTTAATTATCAACACAATTTGCCTATTTGCTTCATCTTGCCACAACATTCCTCACATAAGTTTATTTTTTTTGTCCACAACTAAAGATATACATTTCCCAAAGTAGCCACGTAACGGTGTAAGAATTGTTTCCATGTTACTAATTTATGCTGTAGAATAGTGAATTTAAACATGCACAGCACTTTTCAGAGACAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2
                                                                       ...PROTEIN --- Sc ---- 2e-015     NP_013232.1 involved in transcriptional regulation of CUP1. enters nucleus only at the endof mitosis.; Ace2p [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bf ---- 9e-021     CAB92782.1 Krox protein [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 1e-032     BAA36292.1 PEM-4 [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Ce ---- 1e-039     NP_507995.1 predicted CDS, kruppel-like factor (5V159) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-042     NP_995811.1 CG33473-PB [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 2e-042     XP_792818.1 PREDICTED: similar to Kruppel-like factor 6 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xt ---- 6e-043     AAH75511.1 Zinc finger protein 534 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 5e-046     BAE06785.1 zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 1e-047     BAC77069.1 AP-2 repressor [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 1e-051     XP_688593.1 PREDICTED: similar to Kruppel-like factor 12 isoform a [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 6e-052     NP_571934.2 Kruppel-like factor 12 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 5e-076     XP_427367.2 PREDICTED: similar to basic kruppel like factor [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 7e-076     NP_057615.2 Kruppel-like factor 3 (basic) [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Mm ---- 4e-077     XP_999146.1 PREDICTED: similar to Kruppel-like factor 3 (Basic kruppel-like factor) (CACCC-box-binding protein BKLF) (TEF-2) [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBXT2926.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAAATG---------------------------------------------------TGA------------------------------TAAATG---------ATG---------------------------------ATGTGA---------------------------------------------------------------ATG------------------ATG------------------------------------TAAATG---------------------------------------------------------------------------------------------------------TAG---------------------------ATG---------------------TAGTGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld Limb      in                        CBSU6215.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATTGGCAATCAACCCCATGATATCTGCATTTCCTCGGCACGGATATAGGAACCCTGGACTTTTACCANCTTTTGCAACCAGTTGTGGTTCAGCCTGTCCCTTTTATGTATTCCCCACATCTTCAGCAGCCAATAATGGTGTCCACTCTTCTACCAGAGGAGTTGGAGAATCCACACAATAAACACGTGGCAGTAACAGAACCCTATGAAAAACCACCACCTCTAATGAAAACCATAAAAATTGAGCCTGGGCTGGAACAACAAAACCCAGAATTCTACCCAGAACAGTTATCACCTGGAATCAGCACACCACCCAAGGGGATGAATTACGAAAATCACCCTTCGGTTATAGTGCACCCAGGAAAGAGACCTTTGCCAGTGGAATCCCCCGAAACTCAAAGGAAAAGGCGGATACACCGATGTGATTATGAAGGTTGCAACAAAGTTTACACCAAAAGTTCCCATTTAAAGGCACACAGAAGGACACATACAGGGGAAAAGCCTTATCAGTGTACTTGGGAAGGATGCACATGGAAGTTTGCCCGCTCTGATGAACTGACTCGACATTTCCGTAAACACACTGGAATCAAACCATTTCAGTGCCCAGACTGTGACCGCAGCTTTTCCCGCTCGGACCACCTTGCTCTTCACAGAAAGAGACACATGCTTGTCTAAATGCCCTTCTTGCCTTTTATACGCAAAAATATTATTTTTGGATTCA
  5   1   2       bld Tbd1                                 CBXT2926.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTATGAAAAACCACCACCTCTAATGAAAACCATAAAAATTGAGCCTGGGCTGGAACAACAAAACCCAGAATTCTACCCAGAACAGTTATCACCTGGAATCAGCACACCACCCAAGGGGATGAATTACGAAAATCACCCTTCGGTTATAGTGCACCCAGGAAAGAGACCTTTGCCAGTGGAATCCCCCGAAACTCAAAGGAAAAGGCGGATACACCGATGTGATTATGAAGGTTGCAACAAAGTTTACACCAAAAGTTCCCATTTAAAGGCACACAGAAGGACACATACAGGGGAAAAGCCTTATCAGTGTACTTGGGAAGGATGCACATGGAAGTTTGCCCGCTCTGATGAACTGACTCGACATTTCCGTAAACACACTGGAATCAAACCATTTCAGTGCCCAGACTGTGACCGCAGCTTTTCCCGCTCGGACCATCTTGCTCTTCACAGAAAGAGACACATGCTTGTCTAAATGCCCTTCTTGCCTTTTATACACAAAAATATTATTTTTGGATTCAGCTGGTTCTGAATCTACATAATTTTTTTTCCATATGGTCAGTAAATGAGGTCCCCCATGCTTCATTGTACTAACCACGGGTCAGACCTAAGAATGTGAACATTTTCCTACAGAGTCAATGCAGTACCTTCCTGCACACAGTACACCTCAGGAAATACCCCAATGGACAATGTACTGCTTTCTATGTACTTACAAGCCATATTATCTATATTGAATAAGTTATAAATGTATTTAATTATCAACAC
  5   1   2       bld Tbd1      in                         CBXT2934.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACGAAAATCACCCTTCGGTTATAGTGCACCCAGGAAAGAGACCTTTGCCAGTGGAATCCCCCGAAACTCAAAGGAAAAGGCGGATACACCGATGTGATTATGAAGGTTGCAACAAAGTTTACACCAAAAGTTCCCATTTAAAGGCACACAGAAGGACACATACAGGCAGGGGAAAAGCCTTATCAGTGTACTTGGGAAGGATGCACATGGAAGTTTGCCCGCTCTGATGAACTGACTCGACATTTCCGTAAACACACTGGAATCAAACCATTTCAGTGCCCAGACTGTGACCGCAGCTTTTCCCGCTCGGACCATCTTGCTCTTCACAGAAAGAGACACATGCTTGTCTAAATGCCCTTCTTGCCTTTTATACGCAAAAATATTATTTTTGGATTCAGCTGGTTCTGAATCTACATAATTTTTTTTCCATATGGTCAGTAAATGAGGTCCCCCATGCTTCATTGTACTAACCACGGGTCAGACCTAAGAATGTGAACATTTTCCTACAGAGTCAATGCAGTACCTTCCTGCACACAGTACACCTCAGGAAATACCCCAATGGACAATGTACTGCTTTCTATGTACTTACAAGCCATATTATCTATATTGAATAAGTTATAAATGTATTTAATTATCAACACAATTTGCCTATTTGCTTCATCTTGCCACAACATTCCTCACATAAGTTTATTTTTTTTTGTCCACAACTAAAGATATACATTTTCCCAAAGTAGCCACGTAACGGTGTAAGAATTTGTTTCC
  3   1   2      seed Limb      in                        CBSU6215.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACCAAAAGTTCCCATTTAAAGGCACACAGAAGGACACATACAGGGGAAAAGCCTTATCAGTGTACTTGGGAAGGATGCACATGGAAGTTTGCCCGCTCTGATGAACTGACTCGACATTTCCGTAAACACACTGGAATCAAACCATTTCAGTGCCCAGACTGTGACCGCAGCTTTTCCCGCTCGGACCACCTTGCTCTTCACAGAAAGAGACACATGCTTGTCTAAATGCCCTTCTTGCCTTTTATACGCAAAAATATTATTTTTGGATTCAGCTGGTTCTGAATCTACATAATTTTTTTTCCATATGGTCAGTAAATGAGGTCCCCCATGCTTCATTGTACTAACCACGGGTCAGACCTAAGAATGTGAACATTTTCCTACAGAGTCAATGCAGTACCTTCCTGCACACAGTACACCTCAGGAAATACCCCAATGGACAATGTACTGCTTTCTATGTACTTACAAGCCATATTATCTATATTGAATAAGTTATAAATGTATTTAATTATCAACACAATTTGCCTATTTGCTTCATCTTGCCACAACATTCCTCACATAAGTTTATTTTTTTTGTCCACAACTAAAGATATACATTTCCCAAAGTAGCCACGTAACGGTGTAAGAATTGTTTCCATGTTACTAATTTATGCTGTAGAATAGTGAATTTAAACATGCACAGCACTTTTCAGAGACAC
  3   1   2       bld Tbd1      in                         CBXT2934.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGTGCCCAGACTGTGACCGCAGCTTTTCCCGCTCGGACCATCTTGCTCTTCACAGAAAGAGACACATGCTTGTCTAAATGCCCTTCTTGCCTTTTATACGCAAAAAATATTATTTTTGGATTCAGCTGGTTCTGAATCTACATAATTTTTTTTCCATATGGTCAGTAAATGAGGTCCCCCATGCTTCATTGTACTAACCACGGGTCAGACCTAAGAATGTGAACATTTTCCTACAGAGTCAATGCAGTACCTTCCTGCACACAGTACACCTCAGGAAATACCCCAATGGACAATGTACTGCTTTCTATGTACTTACAAGCCATATTATCTATATTGAATAAGTTATAAATGTATTTAATTATCAACACAATTTGCCTATTTGCTTCATCTTGCCACAACATTCCTCACATAAGTTTATTTTTTTTGTCCACAACTAAAGATATACATTTCCCAAAGTAGCCACGTAACGGTGTAAGAATTGTTTCCATGTTACTAATTTATGCTGTAGAATAGTGAATTTAAACATGCACAGCACTTTTCAGAGACACAATCAACAGCCTGTGTTTAGGTTTGTAAAACATCAATCAGTTGGTACGTCAACGGTGACGCTTCTTTTTTGCCCAATTTGCAGCTCATGTTAACAAAATATTCATAAAAATGTAATGTAATTTGTTTTGGAGTAATTATTGTATATTTGCAGATATACAATGTCAGGTGTCTCAAGTGACTTACTGAAATAATAGTTTTTTTTTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)