Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK6385.5                           11 END     2          28       22                Unknown (protein for IMAGE:7793882) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012093687 Xt7.1-CAAJ13144.3 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ13144.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGGTGAGAAGGCANGTTTTAAAAAACCACCATGATCAAAAAGCTTCTTCACAATGGAATACAATAGAATCTTCCAAAACCAGTAAAGATCCTATAGAAGACATTAATTCTCCAGAGCATATACAGAGACGGCTCTCCTTACAACTACCCATCCTACATCATGCCTACTTGCCATCAATAGGTGGTGTTGATGCCAGCTGTGCTAGCCCATGTGTAAGTCCTAGTGCCAGTCCCCGACATAGACATGTGCAACCTTCTTTTCAAGTCATGGTCTCTGGCCTGTAGGAATAGGTAACACAGGCTTCTTGGACTGCTTCTGTAATCTCAAGAAGGTCTAGACTGCACAAACAAAAACTTTGCTATACATGAAACATTTGCTCTTAAAACAGAGGAGAATACAGTCTAGGGACATAATTCCAAGAGTCCAATATCAACCAGCGTGAGCGAGAGAAGTGAGAGATGCATAAAGACATACCTGGAGCCTTATCTGTGGAGTTTTTATTTCTTTACTCAGAGGACAATGATGAATTCTTCCCAAAACTCTGCGAGCATCAGATCAAGCGCAGAGAACCTATATTCTTGCACAAAAAGAAAAACAAATTACAGAAGATGAACTTTTTAACCCAAGTTACAATTCTAAATATATGGCTGCTATAAACAATGGTTAGTACACTTTATACACATGTAAAAATCTTTTAAAAAAATCATCAAAAAGGAAAATGGCACAGATAGAAATCATTTGCAGAAAATTGTACACGGGTTTGCACAGATATGATCAACGCATTCCATACAGATTTATCCTGCTAGTGTGTCACATCTAAGACTATACACAGTGGGGAAAACGCATCCTTATTAAAGATCCCTCAGGTGTCAGTGAGACATGCAGTATTACCAAGGTTTTGTGCCTGTAACTGAACTATACTGTTTTGACACTGTAGTTTCAGAAGCAGCATGGAGCTGTTAGGTAACCAAGGTTTTATTGTACTGAGCAAGAACAATTTGCAGCACAGCACTTCGCAGAATTTGGGAACAGCTCTGTTTCACTGCTCGCCATTTGGGACAATGTTTTACTCTCTGTAATTTTTTTTCTTTTTAAGAAATGCACAGACTTAATTGAAATGCAGGTTTGAGAACTAGTACATAGCTTAAATGTCACATGATGGATGATTTGTCACAGTTATTGTATTTAATTTGTTCTATACAGTGCCACACTTAAAAAAACTACAATAAAACCAATGTTATAACAGATTCCGGTTCTTTAGGCACATTAGGAGCTATAAAGCTTTGAGCCGGTAATGTGTTAAATTCTTTTTACTGTGCATTTAGCCAACCCCTGAGAATTTTGTATAATTTTCCAACAATTAAGTGGGTTTGAAAGTAAATTTTCTAAATTTGTGACATATGAAAGACAAGATGGAGATCTGAGGAGATTTGCTGAATGCAGGCAGACAGGATAATAGAAAAACGATACATAGCCAAGAAATAAATAATATGTTTTGGCATAATGTGAAAGTATATCTCAGGGGTAGATCATCTTCCATTCTGAAACCCTTTCACTTGTTAATTGTTTTAAGGAACCTGTTTAAAACAGTAACATTAAAAAAAAATCAACATACATATATCCAACAGGTGTTTGGGCTGATACAAGTATGTATAAGTACCTGTATGTAAGAAAACCATTTCCATCATGGTTTTCTGAGCAAACAGCCTGTCACAAAATTGCATGACTTTCCACTATCATTCTTTTAGAATGGGCAACAAAAATCACTATCATCTATAGGCAATGCTATTATTTTAATAATTAGCCAAAAGCCATTCAAATTAATTGATTGCAGTGTTCATTTACAATGCTTTATACTTCTTATTTGAACACAATTCCTAAATCTATGAAAGATAAAATGGGGGCTGCATTTTTTTATGTGTCACGGAAATTGCATTTTTGGAAAAGTTAAAATTAGTACCTGTAAAAATGGTAGTTTGTGAATAAACATTATAAAAAAAAA
                                                  Xt7.1-CHK-1008239383                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAAGGCANGTTTTAAAAAACCACCATGATCAAAAAGCTTCTTCACAATGGAATACAATAGAATCTTCCAAAACCAGTAAAGATCCTATAGAAGACATTAATTCTCCAGAGCATATACAGAGACGGCTCTCCTTACAACTACCCATCCTACATCATGCCTACTTGCCATCAATAGGTGGTGTTGATGCCAGCTGTGCTAGCCCATGTGTAAGTCCTAGTGCCAGTCCCCGACATAGACATGTGCAACCTTCTTTTCAAGTCATGGTCTCTGGCCTGTAGGAATAGGTAACACAGGCTTCTTGGACTGCTTCTGTAATCTCAAGAAGGTCTAGACTGCACAAACAAAAACTTTGCTATACATGAAACATTTGCTCTTAAAACAGAGGAGAATACAGTCTAGGGACATAATTCCAAGAGTCCAATATCAACCAGCGTGAGCGAGAGAAGTGAGAGATGCATAAAGACATACCTGGAGCCTTATCTGTGGAGTTTTTATTTCTTTACTCAGAGGACAATGATGAATTCTTCCCAAAACTCTGCGAGCATCAGATCAAGCGCAGAGAACCTATATTCTTGCACAAAAAGAAAAACAAATTACAGAAGATGAACTTTTTAACCCAAGTTACAATTCTAAATATATGGCTGCTATAAACAATGGTTAGTACACTTTATACACATGTAAAAATCTTTTAAAAAAATCATCAAAAAGGAAAATGGCACAGATAGAAATCATTTGCAGAAAATTGTACACGGGTTTGCACAGATATGATCAACGCATTCCATACAGATTTATCCTGCTAGTGTGTCACATCTAAGACTATACACAGTGGGGAAAACGCATCCTTATTAAAGATCCCTCAGGTGTCAGTGAGACATGCAGTATTACCAAGGTTTTGTGCCTGTAACTGAACTATACTGTTTTGACACTGTAGTTTCAGAAGCAGCATGGAGCTGTTAGGTAACCAAGGTTTTATTGTACTGAGCAAGAACAATTTGCAGCACAGCACTTCGCAGAATTTGGGAACAGCTCTGTTTCACTGCTCGCCATTTGGGACAATGTTTTACTCTCTGTAATTTTTTTTCTTTTTAAGAAATGCACAGACTTAATTGAAATGCAGGTTTGAGAACTAGTACATAGCTTAAATGTCACATGATGGATGATTTGTCACAGTTATTGTATTTAATTTGTTCTATACAGTGCCACACTTAAAAAAACTACAATAAAACCAATGTTATAACAGATTCCGGTTCTTTAGGCACATTAGGAGCTATAAAGCTTTGAGCCGGTAATGTGTTAAATTCTTTTTACTGTGCATTTAGCCAACCCCTGAGAATTTTGTATAATTTTCCAACAATTAAGTGGGTTTGAAAGTAAATTTTCTAAATTTGTGACATATGAAAGACAAGATGGAGATCTGAGGAGATTTGCTGAATGCAGGCAGACAGGATAATAGAAAAACGATACATAGCCAAGAAATAAATAATATGTTTTGGCATAATGTGAAAGTATATCTCAGGGGTAGATCATCTTCCATTCTGAAACCCTTTCACTTGTTAATTGTTTTAAGGAACCTGTTTAAAACAGTAACATTAAAAAAAAATCAACATACATATATCCAACAGGTGTTTGGGCTGATACAAGTATGTATAAGTACCTGTATGTAAGAAAACCATTTCCATCATGGTTTTCTGAGCAAACAGCCTGTCACAAAATTGCATGACTTTCCACTATCATTCTTTTAGAATGGGCAACAAAAATCACTATCATCTATAGGCAATGCTATTATTTTAATAATTAGCCAAAAGCCATTCAAATTAATTGATTGCAGTGTTCATTTACAATGCTTTATACTTCTTATTTGAACACAATTCCTAAATCTATGAAAGATAAAATGGGGGCTGCATTTTTTTATGTGTCACGGAAATTGCATTTTTGGAAAAGTTAAAATTAGTACCTGTAAAAATGGTAGTTTGTGAATAAACATTATAAAAAAAAAATGACA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                                                       ...PREDICTED - Dr ---- 1e-033     XP_688755.1 PREDICTED: similar to Gamma-aminobutyric acid type B receptor, subunit 2 precursor (GABA-B receptor 2) (GABA-B-R2) (Gb2) (GABABR2) [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Mm ---- 6e-039     XP_993445.1 PREDICTED: similar to Gamma-aminobutyric acid type B receptor, subunit 2 precursor (GABA-B receptor 2) (GABA-B-R2) (Gb2) (GABABR2) (G-protein coupled receptor 51) isoform 2 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                       
                                                                       ...PROTEIN --- Hs ---- 5e-039     NP_005449.5 G protein-coupled receptor 51 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 3e-039     XP_419066.2 PREDICTED: similar to GABA-B receptor [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 4e-045     AAH94173.1 LOC733216 protein [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Xt ---- 8e-047     NP_001016007.1 hypothetical protein LOC548761 [Xenopus tropicalis] -------------=================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ13144.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TAG---TAG---------------------------------------------------------------------------TGA------------TAA---------------------------TAA---------------------------------------TGA---ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------TAA---ATG---------------------------------TAA------------------------------TAG---------------------------------------ATG------------------------------TAG---------------------------------------------------------------------------------------------------------TGA------------TGA---------------------ATG------------------------------------------------------------------------------------------------------------ATG------------TAA------------------------------TAA---------------------TAG---------TAAATG------------TGA------------------------------------------------------------TAA---------------------------------------------------------------TAA---------------------------TAG---------------------TAA------------TAA------------------------------TGA---ATG---------ATG------TGA------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAA---------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------TGA------------------TGA---------------------------ATG------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                   ]
  5   1   2      skin TpA  FLt5 in                   TTpA007e11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGAAAGGTCACAATGCAGCTTCAGGATATACCAGAAAAAACAACATATATCAAACAGAACCATTACCAGGACCTGAATGATATTCTAAGTATTCGAAACTTCACAGACAATAAAGATGGTGAGAAGGCANGTTTTAAAAAACCACCATGATCAAAAAGCTTCTTCACAATGGAATACAATAGAATCTTCCAAAACCAGTAAAGATCCTATAGAAGACATTAATTCTCCAGAGCATATACAGAGACGGCTCTCCTTACAACTACCCATCCTACATCATGCCTACTTGCCATCAATAGGTGGTGTTGATGCCAGCTGTGCTAGCCCATGTGTAAGTCCTAGTGCCAGTCCCCGACATAGACATGTGCAACCTTCTTTTCAAGTCATGGTCTCTGGCCTGTAGGAATAGGTAACACAGGCTTCTTGGACTGCTTCTGTAATCTCAAGAAGGTCTAGACTGCACAAACAAAAACTTTGCTATACATGAAACATTTGCTCTTAAAACAGAGGAGAATACAGTCTAGGGACATAATTCCAAGAGTCCAATATCAACCAGCGTGAGCGAGAGAAGTGAGAGATGCATAAAGACATACCTGGAGCCTTATCTGTGGAGTTTTTATTTCTTTACTCAGAGGACAATGATGAATTCTTCCCAAAACTCTGCGAGCATCAGATCAAGCGCAGAGAACCTATATTCTTGCACAAAAAGAAAAACAAATTACAGAAGATGAACTTTTTAACCCAAGTTACAATTCTAAATATATGGCTGCTATAAACAATGGTTAGTACACTTTATACACATGTAAAAATCTTTTAAAAAAATCATCAAAAAGGAAAATGGCACAGATAGAAATCATTTGCAGAAAATTGTACACGGGTTTGCACAGATATGATCAACGCATTCCATAC
  5   1   2      skin Brn4      in                        CAAL21456.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTATTACTTACAGATGGTGAGAAGGCANGTTTTAAAAAACCACCATGATCAAAAAGCTTCTTCACAATGGAATACAATAGAATCTTCCAAAACCAGTAAAGATCCTATAGAAGACATTAATTCTCCAGAGCATATACAGAGACGGCTCTCCTTACAACTACCCATCCTACATCATGCCTACTTGCCATCAATAGGTGGTGTTGATGCCAGCTGTGCTAGCCCATGTGTAAGTCCTAGTGCCAGTCCCCGACATAGACATGTGCAACCTTCTTTTCAAGTCATGGTCTCTGGCCTGTAGGAATAGGTAACACAGGCTTCTTGGACTGCTTCTGTAATCTCAAGAAGGTCTAGACTGCACAAACAAAAACTTTGCTATACATGAAACATTTGCTCTTAAAACAGAGGAGAATACAGTCTAGGGACATAATTCCAAGAGTCCAATATCAACCAGCGTGAGCGAGAGAAGTGAGAGATGCATAAAGACATACCTGGAGCCTTATCTGTGGAGTTTTTATTTCTTTACTCAGAGGACAATGATGAATTCTTCCCAAAACTCTGCGAGCATCAGATCAAGCGCAGAGAACCTATATTCTTGCACAAAAAAAAAAAAAAA
  3   1   2       bld Brn4      in                        CAAL21456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATTACTTACAGATGGTGAGAAGGCAGTTTTAAAAAACCACCATGATCAAAAAGCTTCTTCACAATGGAATACAATAGAATCTTCCAAAACCAGTAAAGATCCTATAGAAGACATTAATTCTCCAGAGCATATACAGAGACGGCTCTCCTTACAACTACCCATCCTACATCATGCCTACTTGCCATCAATAGGTGGTGTTGATGCCAGCTGTGCTAGCCCATGTGTAAGTCCTAGTGCCAGTCCCCGACATAGACATGTGCAACCTTCTTTTCAAGTCATGGTCTCTGGCCTGTAGGAATAGGTAACACAGGCTTCTTGGACTGCTTCTGTAATCTCAAGAAGGTCTAGACTGCACAAACAAAAACTTTGCTATACATGAAACATTTGCTCTTAAAACAGAGGAGAATACAGTCTAGGGACATAATTCCAAGAGTCCAATATCAACCAGCGTGAGCGAGAGAAGTGAGAGATGCATAAAGACATACCTGGAGCCTTATCTGTGGAGTTTTTATTTCTTTACTCAGAGGACAATGATGAATTCTTCCCAAAACTCTGCGAGCATCAGATCAAGCGCAGAGAACCTATATTCTTGCAC
  5   1   2       bld Tad5                                 XZT27256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTAATATATGGCTGCTATAAACAATGGTTAGTACACCTTTATACACATGTAAAAATCTTTTAAAAAAATCATCAAAAAGGAAAATGGCACAGATAGAAATCATTTGCAGAAAATTGTACACGGGTTTGCACAGATATGATCAACGCATTCCATACAGATTTATCCTGCTAGTGTGTCACATCTAAGACTATACACAGTGGGGAAAACGCATCCTTATTAAAGATCCCTCAGGTGTCAGTGAGACATGCAGTATTACCAAGGTTTTGTGCCTGTAACTGAACTATACTGTTTTGACACTGTAGTTTCAGAAGCAGCATGGAGCTGTTAGGTAACCAAGGTTTTATTGTACTGAGCAAGAACAATTTGCAGCACAGCACTTCGCAGAATTTGGGAACAGCTCTGTTTCACTGCTCGCCATTTGGGACAATGTTTTACTCTCTGTAATTTTTTTTCTTTTTAAGAAATGCACAGACTTAATTGAAATGCAGGTTTGAGAACTAGTACATAGCTTAAATGTCACATGATGGATGATTTGTCACAGTTATTGTATTTAATTTGTTCTATACAGTGCCACACTTAAAAAAACTACAATAAAACCAATGTTATAACAGATTCCGGTTCTTTAGGCACATTAGGAGCTATAAAGCTTTGAGCCGGTAATGTGTTAAATTCTTTTTACTGTGCATTTAGCCAACCCCTGAGAATTTTGTATAATTTTCCAACAATTAAGTGGGTTTGAAAGTAAATTTTCTAAATTTGTGACATATGAAAGACAAGATGGAGATCTGAGGAGATTTGCTGAATGCAGGCAGACAGGATAATAGAAAAACGATACATAGCCCAGAAATAAATAATATGTTTTGG
  3   1   2      seed Brn2 5g3  out                       CAAJ13144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTAGGAGCTATAAAGCTTTGAGCCGGTAATGTGTTAAATTCTTTTTACTGTGCATTTAGCCAACCCCTGAGAATTTTGTATAATTTTCCAACAATTAAGTGGGTTTGAAAGTAAATTTTCTAAATTTGTGACATATGAAAGACAAGATGGAGATCTGAGGAGATTTGCTGAATGCAGGCAGACAGGATAATAGAAAAACGATACATAGCCAAGAAATAAATAATATGTTTTGGCATAATGTGAAAGTATATCTCAGGGGTAGATCATCTTCCATTCTGAAACCCTTTCACTTGTTAATTGTTTTAAGGAACCTGTTTAAAACAGTAACATTAAAAAAAAATCAACATACATATATCCAACAGGTGTTTGGGCTGATACAAGTATGTATAAGTACCTGTATGTAAGAAAACCATTTCCATCATGGTTTTCTGAGCAAACAGCCTGTCACAAAATTGCATGACTTTCCACTATCATTCTTTTAGAATGGGCAACAAAAATCACTATCATCTATAGGCAATGCTATTATTTTAATAATTAGCCAAAAGCCATTCAAATTAATTGATTGCAGTGTTCATTTACAATGCTTTATACTTCTTATTTGAACACAATTCCTAAATCTATGAAAGATAAAATGGGGGCTGCATTTTTTTATGTGTCACGGAAATTGCATTTTTGGAAAAGTTAAAATTAGTACCTGTAAAAATGGTAGTTTGTGAATAAACATTATAAAAAAAAAATGACAATTTT
  3   1   2       bld Tad5 5g3  out                         XZT8925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGAATTTTGTATAATTTTCCAACAATTAAGTGGGTTTGAAAGTAAATTTTCTAAATTTGTGACATATGAAAGCCAAGATGGAGATCTGAGGAGATTTGCTGAATGCAGGCAGACAGGATAATAGAAAAACGATACATAGCCAAGAAATAAATAATATGTTTTGGCATAATGTGAAAGTATATCTCAGGGGTAGATCATCTTCCATTCTGAAACCCTTTCACTTGTTAATTGTTTTAAGGAACCTGTTTAAAACAGTAACATTAAAAAAAAATCAACATACATATATCCAACAGGTGTTTGGGCTGATACAAGTATGTATAAGTACCTGTATGTAAGAAAACCATTTCCATCATGGTTTTCTGAGCAAACAGCCTGTCACAAAATTGCATGACTTTCCACTATCATTCTTTTAGAATGGGCAACAAAAATCACTATCATCTATAGGCAATGCTATTATTTTAATAATTAGCCAAAAGCCATTCAAATTAATTGATTGCAGTGTTCATTTACAATGCTTTATACTTCTTATTTGAACACAATTCCTAAATCTATGAAAGATAAAATGGGGGCTGCATTTTTTTATGTGTCACGGAAATTGCATTTTTGGAAAAGTTAAAATTAGTACCTGTAAAAATGGTAGTTTGTGAATAAACATTTAAAAAAAAAAAAAAA
  3   1   2       bld TpA  FLt5 in                    TTpA007e11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATAATAGAAAAACGATACATAGCCAAGAAATAAATAATATGTTTTGGCATAATGTGAAAGTATATCTCAGGGGTAGATCATCTTCCATTCTGAAACCCTTTCACTTGTTAATTGTTTTAAGGAACCTGTTTAAAACAGTAACATTAAAAAAAAATCAACATACATATATCCAACAGGTGTTTGGGCTGATACAAGTATGTATAAGTACCTGTATGTAAGAAAACCATTTCCATCATGGTTTTCTGAGCAAACAGCCTGTCACAAAATTGCATGACTTTCCACTATCATTCTTTTAGAATGGGCAACAAAAATCACTATCATCTATAGGCAATGCTATTATTTTAATAATTAGCCAAAAGCCATTCAAATTAATTGATTGCAGTGTTCATTTACAATGCTTTATACTTCTTATTTGAACACAATTCCTAAATCTATGAAAGATAAAATGGGGGCTGCATTTTTTTATGTGTCACGGAAATTGCATTTTTGGAAAAGTTAAAATTAGTACCTGTAAAAATGGTAGTTTGTGAATAAACATTATAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)