Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 85%

 1012093882 Xt7.1-TTbA038c23.3 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA038c23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCTGTGAAGATTAAACCAAGACTCTTTCTCTACTATTACTTCTGTAGCTATCTCCCTCCCTGCCTGGAACTCTCTCCCCCCACCAGTCACTACCACTCAAATCTCAAAAGCCGGGAGGATATTACATTGAGGCTGATCCATTTGTTTGCCTGCAGCTAAGTGCAGTTCAGGAAGACACAGCCAGCACAAGGGATGTTTCTAGACAAATGTGAAGATTTGTGTGACTTGAGGGAAGACGGCAGCACCCCAACACCTGGCACTCCAGAAGGGGAGGATAATGAGCTACCTAAAAAGAAACACCGCAGGAACCGAACGACTTTCACAACCTATCAGCTTCATGAATTAGAGCGTGCCTTTGAGCGCTCACACTATCCTGATGTGTACAGTCGAGAGGAGCTGGCTATGAAGGTTAGCCTGCCAGAAGTTAGAGTCCAGGTTTGGTTCCAGAACAGGCGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGACTTCCTCTAGCAAGCTACATGATTCCCCACTATTATCATTCTCACGATCCCCAATGGCTACAGGTGTGGGGCCTTTGAGCAACACTTTACCACTGGAACCATGGCTCACCTCACCAATCCCAGGGACTACTACTGTTCACAGTATGCCAGCTTTCATGGCTCCATCCCAGGCCCTTCAGCCCACTTACCAAAGTCACACATTTTTGAACAGTGGCCCTCCAATGACCCCTATCCAACCTCTCAGCGGTGCTCCTTATCAGTGCATGGGGGGATTCATGGACAAATTTCCCTTAGAGGAAATGGACCAAAGAAGTTCAAGCATTGCTGCACTGAGAATGAAGGCAAAGGAGCACATCCAGACCATAGATAAGACATGGCAGCCTATCTGATCAAAACACCCGTTACACTTTTTGACTTTAAGCCTGGCAATTCTTAGACCTGGATTTATTCAAGCCAAAGAAGTCACATGGAATATGCTATAGAACTTAAATAAAGGGACCTGTTTACTTGTAGGTGGGACAAATGTGACTAATACATTGTTGTAAGGATGATTATTGAAAACAGACTTGCGTATTAGAAGCTGATGTCTCTGTGTTAGTTTTATTTCATTGGGTCTGGTGTTGGCCAGTCAGTACTCCATTTAACGAGAAAATAAATAAAAACACAGCAGAAGATTAAAAAAAAAAA
                                                  Xt7.1-CHK-1008245172                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAGATTAAACCAAGACTCTTTCTCTACTATTACTTCTGTAGCTATCTCCCTCCCTGCCTGGAACTCTCTCCCCCCACCAGTCACTACCACTCAAATCTCAAAAGCCGGGAGGATATTACATTGAGGCTGATCCATTTGTTTGCCTGCAGCTAAGTGCAGTTCAGGAAGACACAGCCAGCACAAGGGATGTTTCTAGACAAATGTGAAGATTTGTGTGACTTGAGGGAAGACGGCAGCACCCCAACACCTGGCACTCCAGAAGGGGAGGATAATGAGCTACCTAAAAAGAAACACCGCAGGAACCGAACGACTTTCACAACCTATCAGCTTCATGAATTAGAGCGTGCCTTTGAGCGCTCACACTATCCTGATGTGTACAGTCGAGAGGAGCTGGCTATGAAGGTTAGCCTGCCAGAAGTTAGAGTCCAGGTTTGGTTCCAGAACAGGCGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGACTTCCTCTAGCAAGCTACATGATTCCCCACTATTATCATTCTCACGATCCCCAATGGCTACAGGTGTGGGGCCTTTGAGCAACACTTTACCACTGGAACCATGGCTCACCTCACCAATCCCAGGGACTACTACTGTTCACAGTATGCCAGCTTTCATGGCTCCATCCCAGGCCCTTCAGCCCACTTACCAAAGTCACACATTTTTGAACAGTGGCCCTCCAATGACCCCTATCCAACCTCTCAGCGGTGCTCCTTATCAGTGCATGGGGGGATTCATGGACAAATTTCCCTTAGAGGAAATGGACCAAAGAAGTTCAAGCATTGCTGCACTGAGAATGAAGGCAAAGGAGCACATCCAGACCATAGATAAGACATGGCAGCCTATCTGATCAAAACACCCGTTACACTTTTTGACTTTAAGCCTGGCAATTCTTAGACCTGGATTTATTCAAGCCAAAGAAGTCACATGGAATATGCTATAGAACTTAAATAAAGGGACCTGTTTACTTGTAGGTGGGACAAATGTGACTAATACATTGTTGTAAGGATGATTATTGAAAACAGACTTGCGTATTAGAAGCTGATGTCTCTGTGTTAGTTTTATTTCATTGGGTCTGGTGTTGGCCAGTCAGTACTCCATTTAACGAGAAAATAAATAAAAACACAGCAGAAGATTAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN     194      80                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     194     169                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     194       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Br ==== 2e-024     ABD62780.1 Rx homeobox protein [Branchiostoma lanceolatum] ==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bf ---- 3e-025     CAA11364.1 Pax6 [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 2e-025     ABK54278.1 Pax6 [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 1e-026     NP_492246.2 C.Elegans Homeobox family member (ceh-8) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 3e-032     BAE06677.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 1e-039     XP_782307.1 PREDICTED: similar to Retinal homeobox protein Rx3 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-041     NP_726006.2 CG10052-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Hs ---- 4e-047     NP_116142.1 hypothetical protein LOC84839 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 7e-068     NP_038861.2 retina and anterior neural fold homeobox [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dr ---- 1e-085     NP_571300.2 retinal homeobox gene 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 2e-092     XP_001232119.1 PREDICTED: retina and anterior neural fold homeobox [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 3e-119     ABC96115.1 retinal homeobox-like transcription factor [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 3e-119     NP_001089185.1 retinal homeobox-like transcription factor [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA038c23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------ATG---------------------------------------ATG---------ATG---------------------ATG---------------------------------ATG------------------------------------------------TGA------------------------------------------------------------------------------------ATG---TAG------------------------------------------------------------TAA---TGA------------------------------TGA---------------------------------------------------------TAA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2   10  bld Tbd1 5g3  in                        CBXT20904.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCTGTGAAGATTAAACCAAGACTCTTTCTCTACTATTACTTCTGTAGCTATCTCCCTCCCTGCCTGGAACTCTCTCCCCCCACCAGTCACTACCACTCAAATCTCAAAAGCCGGGAGGATATTACATTGAGGCTGATCCATTTGTTTGCCTGCAGCTAAGTGCAGTTCAGGAAGACACAGCCAGCACAAGGGATGTTTCTAGACAAATGTGAAGATTTGTGTGACTTGAGGGAAGACGGCAGCACCCCAACACCTGGCACTCCAGAAGGGGAGGATAATGAGCTACCTAAAAAGAAACACCGCAGGAACCGAACGACTTTCACAACCTATCAGCTTCATGAATTAGAGCGTGCCTTTGAGCGCTCACACTATCCTGATGTGTACAGTCGAGAGGAGCTGGCTATGAAGGTTAGCCTGCCAGAAGTTAGAGTCCAGGTTTGGTTCCAGAACAGGCGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGACTTCCTCTAGCAAGCTACATGATTCCCCACTATTATCATTCTCACGATCCCCAATGGCTACAGTTGTGGGGCCTTTGAGCAACACTTTACCACTGGAACCATGGCTCACCTCACCAATCCCAGGGACTACTACTGTTCACAGTATGCCAGCTTTCATGGCTCCATCCCAGGCCCTTCAGCCCACTTACCAAAGTCACACATTTTTGAACAGTGGCCCTCCAATGACCCCTATCCAACCTCTCAGCGGTGCTCCTTATCAGTGCATGGGGGGATTCATGGACAAATTTCCCTTAGAGGAAATGGAC
  5   1   2       bld TbA       in                   TTbA038c23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGGAAAAGCAGAGGGAGCACCCCAACACCTGGCACTCCAGAAGGGGAGGATAATGAGCTACCTAAAAAGAAACACCGCAGGAACCGAACAACTTTCACAACCTATCAGCTTCATGAATTAGAGCGTGCCTTTGAGCGCTCACACTATCCTGATGTGTACAGTCGAGAGGAGCTGGCTATGAAGGTTAGCCTGCCAGAAGTTAGAGTCCAGGTTTGGTTCCAGAACAGGCGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGACTTCCTCTAGCAAGCTACATGATTCCCCACTATTATCATTCTCACGATCCCCAATGGCTACAGGTGTGGGGCCTTTGAGCAACACTTTACCACTGGAACCATGGCTCACCTCACCAATCCCAGGGACTACTACTGTTCACAGTATGCCAGCTTTCATGGCTCCATCCCAGGCCCTTCAGCCCACTTACCAAAGTCACACATTTTTGAACAGTGGCCCTCCAATGACCCCTATCCAACCTCTCAGCGGTGCTCCTTATCAGTGCATGGGGGGATTCATGGACAAATTTCCCTTAGAGGAAATGGACCAAAGAAGTTCAAGCATTGCTGCACTGAGAATGAAGGCAAAGGAGCACATCCAGACCATAGATAAGACATGGCAGCCTATCTGATCAAAACACCCGTTACACTTTTTGACTTTAAGCCTGGCAATTC
  3   1   2      seed TbA       in                    TTbA038c23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATGAATTAGAGCGTGCCTTTGAGCGCTCACACTATCCCTGATGTGTACAGTCGAGAGGAGCTGGCTATGAAGGTTAGCCTGCCAGAAGTTAGAGTCCAGGTTTGGTTCCAGAACAGGCGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGACTTCCTCTAGCAAGCTACATGATTCCCCACTATTATCATTCTCACGATCCCCAATGGCTACAGGTGTGGGGCCTTTGAGCAACACTTTACCACTGGAACCATGGCTCACCTCACCAATCCCAGGGACTACTACTGTTCACAGTATGCCAGCTTTCATGGCTCCATCCCAGGCCCTTCAGCCCACTTACCAAAGTCACACATTTTTGAACAGTGGCCCTCCAATGACCCCTATCCAACCTCTCAGCGGTGCTCCTTATCAGTGCATGGGGGGATTCATGGACAAATTTCCCTTAGAGGAAATGGACCAAAGAAGTTCAAGCATTGCTGCACTGAGAATGAAGGCAAAGGAGCACATCCAGACCATAGATAAGACATGGCAGCCTATCTGATCAAAACACCCGTTACACTTTTTGACTTTAAGCCTGGCAATTCTTAGACCTGGATTTATTCAAGCCAAAGAAGTCACATGGAATATGCTATAGAACTTAAATAAAGGGACCTGTTTACTTGTAGGTGGGACAAATGTGACTAATACATTGTTGTAAGGATGATTATTGAAAACAGACTTGCGTATTAGAAGCTGATGTCTCTGTGTTAGTTTTATTTCATTGGGTCTGGTGTTGGCCAGTCAGTACTCCATTTAACGAGAAAATAAATAAAAACACAGCAGAAGATTAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tbd1 5g3  in                        CBXT20904.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAGCCCTGCCAGAAAGTTAGAGTCCAGGTTGGTTCCAGAACAGGCGAGCAAAATGGAGGCGGCAAGAGAAACTGGAGACTTCCTCTAGCAAGCTACATGATTCCCCACTATTATCATTCTCACGATCCCCAATGGCTACAGTTGTGGGGCCTTTGAGCAACACTTTACCACTGGAACCATGGCTCACCTCACCAATCCCAGGGACTACTACTGTTCACAGTATGCCAGCTTTCATGGCTCCATCCCAGGCCCTTCAGCCCACTTACCAAAGTCACACATTTTTGAACAGTGGCCCTCCAATGACCCCTATCCAACCTCTCAGCGGTGCTCCTTATCAGTGCATGGGGGGATTCATGGACAAATTTCCCTTAGAGGAAATGGACCAAAGAAGTTCAAGCATTGCTGCACTGAGAATGAAGGCAAAGGAGCACATCCAGACCATAGATAAGACATGGCAGCCTATCTGATCAAAACACCCGTTACACTTTTTGACTTTAAGCCTGGCAATTCTTAGACCTGGATTTATTCAAGCCAAAGAAGTCACATGGAATATGCTATAGAACTTAAATAAAGGGACCTGTTTACTTGTAGGTGGGACAAATGTGACTAATACATTGTTGTAAGGATGATTATTGAAAACAGACTTGCGTATTAGAAGCTGATGTCTCTGTGTTAGTTTTATTTCATTGGGTCTGGTGTTGGCCAGTCAGTACTCCATTTAACGAGAAAATAAATAAAAACACAGCAGAAGATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)