Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBSS5297.3                            5 END     1          25       20                calcium/calmodulin-dependent protein kinase kinase 2, beta [Mus musculus]
     2   2.0    0Xt7.1-TTbA001o16.3                          3 END     1          25       33                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012094000 Xt7.1-CAAN6123.5 - 4 ESTs
                                                                       ......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAN6123.5                                                                                                                                                                                                                         GCCGGGAAGAGATTGGCAACTGAAGCCGGCGCTGGCACCGAGCTGCTGTATAGAAAACCTGGTTGCTCTACATTAGCTCAAACCTTCCATGTTGATCAATGGAATTCTGTGATTTGGAAAGTGCTCTGTGTAAGCTCGTGGCTGCAGCCAAATTCAGCCATCTAGAAAGAGTGGATCCTTCTATTGTGAAATCAAATTGGATTTGCAGTTGGTTACCTGGACGATCAAGGGAAGAAATTTGAAGAAGAATATAATAAGAATACTGTTTGTATGTGTGAAAGGTCTGTCATAATGGATTGTGATTCTGACCCAAATCAAGACTCTCAAACAGAACTTGCTGAGCGAGTTGCTGCCATTGAAGTGGATGAAGAATGTCAGGCTCCAGGAAGAATAAATTCTGATGATATGGATGGACTGAAAAACAACTATATGAGCTCTGAGACCAGTGAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGACTTGAGCTCTTTCCAAAGAGCTTCTTCTCGCCCCACTTTGTCAAACAGAAAGTTCTCTCTCCAAGAAAGACCTTCAGGAGGCTGCCTTCCATCCCACAACCTAGCTTATGGTCCATATGCAACAGGTCCTGCATCACACATATCTCCAAGGATTGTTCGAAGGCCAACAATTGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCAGCTGAACCAATACAAGCTACAGAGTGAAATTGGCAAAGGGTCATATGGTGTTGTAAAACTGGCCTACAATCAAAGTGATGACAAGTATTATGTAAGCGAAGTTTAATTTGATTATTTATAAATTTCATTTTTTGTGTGAATATAGTTGTACTCTGTCCAATGTCATCTAATATGATTTGGCACTTGTTATGCTGTGCTCTGTACAATGTTTTGCACCCAGTATAAAGTTAGTTATTTAGCATTTGTGCACAGTTCTAAGAGTATCGGTGTAGGTTTTTCTGGAAACTGATGTGGTTTCATAATATTACAACATCACAGCATTTGCTGATGGGAGTGCTGTACTACGCAGAATAAAAACAGCAATGATTAAAAAAAGCAAATCTTGAAACTCACAGGCATATCATTTCAGCTAGTCTGGCCATGTAATTATGTCTTTAGTATTTCTTTTGATTACAACTCCAGCTTTGTCAATTGGATCAATATATTATTTGTCCACCTCAAGGTGGGGGTATCAGTGAATGATCTGCTAGTTTGGCAACCTTGCCAACAAGGGGATCTTTCCGTGTATGGCCACCTTTACTCAAGAACCCTAATAAACTGGATTTGTATTAATGAAAAGCTAACTAGCATGTGACTGTATAAACAAAATACATTTTAAAAAAATATGGGACCCATGGATCGGATATGTGTGTCTGAGAATGATGGACACTGCCCTCTTCTCATTATGAACAAATTCTCTTTAGTGACTTCTTGGCACAATTAAGCATAAGAGTAATTCCTGTCCTTTGTTTATTGCAAACTTTGTTAATAAAAATATAGTATTCTTTTTTTTCTTTTTCTTTGTTTAATTTTTGTCATTTTGATCGTTTATCGAGTAATAAAAATGTTCTTATGGTTT
                                                  Xt7.1-CHK-1008245531                                                                                                                                                                                                                               AAGAGATTGGCAACTGAAGCCGGCGCTGGCACCGAGCTGCTGTATAGAAAACCTGGTTGCTCTACATTAGCTCAAACCTTCCATGTTGATCAATGGAATTCTGTGATTTGGAAAGTGCTCTGTGTAAGCTCGTGGCTGCAGCCAAATTCAGCCATCTAGAAAGAGTGGATCCTTCTATTGTGAAATCAAATTGGATTTGCAGTTGGTTACCTGGACGATCAAGGGAAGAAATTTGAAGAAGAATATAATAAGAATACTGTTTGTATGTGTGAAAGGTCTGTCATAATGGATTGTGATTCTGACCCAAATCAAGACTCTCAAACAGAACTTGCTGAGCGAGTTGCTGCCATTGAAGTGGATGAAGAATGTCAGGCTCCAGGAAGAATAAATTCTGATGATATGGATGGACTGAAAAACAACTATATGAGCTCTGAGACCAGTGAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGACTTGAGCTCTTTCCAAAGAGCTTCTTCTCGCCCCACTTTGTCAAACAGAAAGTTCTCTCTCCAAGAAAGACCTTCAGGAGGCTGCCTTCCATCCCACAACCTAGCTTATGGTCCATATGCAACAGGTCCTGCATCACACATATCTCCAAGGATTGTTCGAAGGCCAACAATTGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCAGCTGAACCAATACAAGCTACAGAGTGAAATTGGCAAAGGGTCATATGGTGTTGTAAAACTGGCCTACAATCAAAGTGATGACAAGTATTATGTAAGCGAAGTTTAATTTGATTATTTATAAATTTCATTTTTTGTGTGAATATAGTTGTACTCTGTCCAATGTCATCTAATATGATTTGGCACTTGTTATGCTGTGCTCTGTACAATGTTTTGCACCCAGTATAAAGTTAGTTATTTAGCATTTGTGCACAGTTCTAAGAGTATCGGTGTAGGTTTTTCTGGAAACTGATGTGGTTTCATAATATTACAACATCACAGCATTTGCTGATGGGAGTGCTGTACTACGCAGAATAAAAACAGCAATGATTAAAAAAAGCAAATCTTGAAACTCACAGGCATATCATTTCAGCTAGTCTGGCCATGTAATTATGTCTTTAGTATTTCTTTTGATTACAACTCCAGCTTTGTCAATTGGATCAATATATTATTTGTCCACCTCAAGGTGGGGGTATCAGTGAATGATCTGCTAGTTTGGCAACCTTGCCAACAAGGGGATCTTTCCGTGTATGGCCACCTTTACTCAAGAACCCTAATAAACTGGATTTGTATTAATGAAAAGCTAACTAGCATGTGACTGTATAAACAAAATACATTTTAAAAAAATATGGGACCCATGGATCGGATATGTGTGTCTGAGAATGATGGACACTGCCCTCTTCTCATTATGAACAAATTCTCTTTAGTGACTTCTTGGCACAATTAAGCATAAGAGTAATTCCTGTCCTTTGTTTATTGCAAACTTTGTTAATAAAAATATAGTATTCTTTTTTTTCTTTTTCTTTGTTTAATTTTTGTCATTTTGATCGTTTATCGAGTAATAAAAATGTTCTTA
                                                      consensus depths                                                                                                                                                                                                                              1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     270     286                                                                                                                                                                                                                         
                                               BLH MIN     270      50                                                                                                                                                                                                                         
                                               BLH OVR     270     167                                                                                                                                                                                                                         
                                               ORF LNG     270       5                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 8e-010     NP_001021153.1 CaM Kinase Kinase family member (ckk-1) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- Dm ---- 2e-011     NP_001036633.1 CG17698-PC, isoform C [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 2e-013     XP_785473.2 PREDICTED: similar to MGC139717 protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 9e-024     NP_001014361.1 hypothetical LOC541526 [Danio rerio] ===========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 3e-033     NP_061371.1 calcium/calmodulin-dependent protein kinase kinase 1, alpha [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 3e-034     NP_115670.1 calcium/calmodulin-dependent protein kinase 1 alpha isoform a [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Gg ---- 4e-041     XP_001234325.1 PREDICTED: similar to calcium/calmodulin-dependent protein kinase kinase [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 4e-089     BAC19849.1 calcium/calmodulin-dependent protein kinase kinase [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 3e-094     AAI35915.1 Unknown (protein for MGC:121698) [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === ?? ==== 3e-094     NP_001093741.1 calcium/calmodulin-dependent protein kinase kinase 1, alpha [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAN6123.5                                                                                                                                                                                                                                                                                                                                                                                           TAG---------------------TGA---------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TAA---------------TGA---TAG---------------------------TGA------------------------------ATG------------------------------------------------------------------------------TGA------------------------------------TGA---------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGA---------------------TAA------ATG------ATG------------------------------------------------ATG---------------------------------TAA---TAA---TAA------------------------------TAATAA------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2   10  bld Spl2 5g3  out                       CBSS5297.fwd ........................................................................................................................................................................................................................GCCGGGAAGAGATTGGCAACTGAAGCCGGCGCTGGCACCGAGCTGCTGTATAGAAAACCTGGTTGCTCTACATTAGCTCAAACCTTCCATGTTGATCAATGGAATTCTGTGATTTGGAAAGTGCTCTGTGTAAGCTCGTGGCTGCAGCCAAATTCAGCCATCTAGAAAGAGTGGATCCTTCTATTGTGAAATCAAATTGGATTTGCAGTTGGTTACCTGGACGATCAAGGGAAGAAATTTGAAGAAGAATATAATAAGAATACTGTTTGTATGTGTGAAAGGTCTGTCATAATGGATTGTGATTCTGACCCAAATCAAGACTCTCAAACAGAACTTGCTGAGCGAGTTGCTGCCATTGAAGTGGATGAAGAATGTCAGGCTCCAGGAAGAATAAATTCTGATGATATGGATGGACTGAAAAACAACTATATGAGCTCTGAGACCAGTGAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGACTTGAGCTCTTTCCAAAGAGCTTCTTCTCGCCCCACTTTGTCAAACAGAAAGTTCTCTCTCCAAGAAAGACCTTCAGGAGGCTGCCTTCCATCCCACAACCTAGCTTATGGTCCATATGCAACAGGTCCTGCATCACACATATCTCCAAGGATTGTTCGAAGGCCAACAATTGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCAGCTGAACCAATACAAGCTACAGAGTGAAATTGGCAAAATGGGAGCA
  5   1   2   14  bld Te4  5g3  out                        CAAN6123.5p .........................................................................................................................................................................................................................CCGGGAAGAGATTGGCAACTGAAGCCGGCGCTGGCACCGAGCTGCTGTATAGAAAATCTGGTTGCTCTACATTAGCTCAAACCTTCCATGTTGATCAATGGAATTCTGTGATTTGGAAAGTGATCTGTGTAAGCTCGTGGCTGCAGCCAAATTCAGCCATCTAGAAAGAGTGGATCCTTCTATTGTGAAATCAAATTGGATTTGCAGTTGGTTACCTGGACGATCAAGGGAAGAAATTTGAAGAAGAATATAATAAGAATACTGTTTGTATGTGTGAAAGGTCTGTCATAATGGATTGTGATTCTGACCCAAATCAAGACTCTCAAACAGAACTTGCTGAGCGAGTTGCTGCCATTGAAGTGGATGAAGAATGTCAGGCTCCAGGAAGAATAAATTCTGATGATATGGATGGACTGAAAAACAACTATATGAGCTCTGAGACCAGTGAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGACTTGAGCTCTTTCCAAAGAGCTTCTTCTCGCCCCACTTTGTCAAACAGAAAGTTCTCTCTCCAAGAAAGACCTTCAGGAGGCTGCCTTCCATCCCACAACCTAGCTTATGGTCCATATGCAACAGGTCCTGCATCACACATATCTCCAAGGATTGTTCGAAGGCCAACAATTGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCAGCTGAACCAATACAAGCTACAGAGTGAAATTGGCAAAGGGTCATATGGTGTTGTAAAACTGGCCTACAATCAAAGTGATGACAAGTATTATGCAATGAAGGTTCTATCAAAAAAGAGGCTG
  5   1   2      seed Tad5 FL   in                         XZT54539.5p                                                                                                                                                                                                                                                                                                                                                             CTAACATAGGAGTTCTGCAGCAATGCAAACATTCTAATCATGTAAGTTTTTGACATGCTGAGGTGTCGTGCGTGCCTTTTTAGCTGCAACCTACCAAGGAAGAAATTTGAAGAAGAATATAATAAGAATACTGTTTGTATGTGTGAAAGGTCTGTCATAATGGATTGTGATTCTGACCCAAATCAAGACTCTCAAACAGAACTTGCTGAGCGAGTTGCTGCCATTGAAGTGGATGAAGAATGTCAGGCTCCAGGAAGAATAAATTCTGATGATATGGATGGACTGAAAAACAACTATATGAGCTCTGAGACCAGTGAGGATGTATTTCTTTCTTCCCAAGAACAAAGGGACTTGAGCTCTTTCCAAAGAGCTTCTTCTCGCCCCACTTTGTCAAACAGAAAGTTCTCTCTCCAAGAAAGACCTTCAGGAGGCTGCCTTCCATCCCACAACCTAGCTTATGGTCCATATGCAACAGGTCCTGCATCACACATATCTCCAAGGATTGTTCGAAGGCCAACAATTGAGTCCAACCGTGTCTCCATCTCTGATTCAGATGATTGTGTGCAGCTGAACCAATACAAGCTACAGAGTGAAATTGGCAAAGGGTCATATGGTGTTGTAAAACTGGCCTACAATCAAAGTGATGACAAGTATTATGTAAGCGAAGTTTAATTTGATTATTTATAAATTTCATTTTTTGTGTGAATATAGTTGTACTCTGTCCAATGTCATCTAATATGATTTGGCACTTGTTATGCTGTGCTCTGTACAATGTTTTGCACCCAGTATAAAGTTAGTTATTTAGCATTTGTGCACAGTTCT
  3   1   2      skin Tad5 FL   in                         XZT54539.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATATAGTTGTACTCTGTCCAATGTCATCTAATATGATTTGGCACTTGTTATGCTGTGCTCTGTACAATGTTTTGCACCCAGTATAAAGTTAGTTATTTAGCATTTGTGCACAGTTCTAAGAGTATCGGTGTAGGTTTTTCTGGAAACTGATGTGGTTTCATAATATTACAACATCACAGCATTTGCTGATGGGAGTGCTGTACTACGCAGAATAAAAACAGCAATGATTAAAAAAAGCAAATCTTGAAACTCACAGGCATATCATTTCAGCTAGTCTGGCCATGTAATTATGTCTTTAGTATTTCTTTTGATTACAACTCCAGCTTTGTCAATTGGATCAATATATTATTTGTCCACCTCAAGGTGGGGGTATCAGTGAATGATCTGCTAGTTTGGCAACCTTGCCAACAAGGGGATCTTTCCGTGTATGGCCACCTTTACTCAAGAACCCTAATAAACTGGATTTGTATTAATGAAAAGCTAACTAGCATGTGACTGTATAAACAAAATACATTTTAAAAAAATATGGGACCCATGGATCGGATATGTGTGTCTGAGAATGATGGACACTGCCCTCTTCTCATTATGAACAAATTCTCTTTAGTGACTTCTTGGCACAATTAAGCATAAGAGTAATTCCTGTCCTTTGTTTATTGCAAACTTTGTTAATAAAAATATAGTATTCTTTTTTTTCTTTTTCTTTGTTTAATTTTTGTCATTTTGATCGTTTATCGAGTAATAAAAATGTTCTTATGGTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)