Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ3000.3.5                         14 END     3          75       21                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012094319 Xt7.1-CAAJ15839.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ15839.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCATCCAAGCCACGATCGAGAAGCACAAACAGAACAGCGAGACCTTCCGGGCGTTTAACAGTTCCTTTTCCAGAGACGATGAGCATTGCCCCGATTCCCCGGTGCCGGGCACGGGCCCCCCAGATTATTCCTCAGGGATGGACGGCTGCAGCTCTCCTGGAGGGGCCGATTCCTTCCGGAAATCCTGTAAGATAAAGCGGGAGAAGGAGAAGCAAAACTGCAAGGGCTGCGGGGAGAGTTTCAACTCCATAACGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGACAGAGGAGGAGAAGAAGGAATGGATACAGGTCATCCAAGCCACGATCGAGAAGCACAAACAGAACAGCGAGACCTTCCGGGCGTTTAACAGTTCCTTTTCCAGAGACGATGAGCATTGCCCCGATTCCCCGGTGCCGGGCACGGGCCCCCCAGATTATTCCTCAGGGATGGACGGCTGCAGCTCTCCTGGAGGGGCCGATTCCTTCCGGAAATCCTGTAAGATAAAGCGGGAGAAGGAGAAGCAAAACTGCAAGGGCTGCGGGGAGAGTTTCAACTCCATAACGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGTGATTTGCGCAAAGTGCTCGGAGTTCAAGCTGCTGGCGGAGAACAGTCGGCATAACCGGGTCTGTAAGGAGTGTTTCCCTCTCGTCTCCTCTGTCTCGGGGAGTCCGGGGGGCACCACAGAGTCGGGGGACACAAAGAAGAAAGTGGAGAAGCAGAATTCCTTGTCTCCGGAAAACTGTGTGTTCAGCAGTAGCCTCCTGTTCCTGGAGAAGGGGAGAACGTGGACGAAAGTGTGGGTGTCGGTGCCCAGGAACGAGCCCCTCGTCATGTATCTGCAGGGGGGCAGCCAGGATGGGCGGCCCCCCCGGGCAATACCGTTGCCAGGATACGAAGTGGGTTTGCCAAGCGCCGGTGACAAAGTGGACTTGAAACACGTATTTAAACTGTCGCAGTCGCAGCAAGTTCTGTTCTTCGGGGCGGAGGATGAGGATTTGCTGCAGAAGTGGAAGGGGATTCTCAGTAAAGCCTCTCGGGGGGACCCCCCCATTGTGGCAGAGGATCCAGAAAAGCTCTAGAACCTCTTGTGCTCTTGAAGCCGACTGGGAATCTCCACTAGGACCCAGGAGAGACTTTGTCCTGCACGTAACTCGCTGTACAACAGGGGGCGCCAACACGTACCTCTCCGGCTATGGCCGGACTCTTGACTTGCACGGGATGCTGGGAGTTGTTGGCCGTTTGTCCCTGCGTC
                                                  Xt7.1-CHK-1008244518                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGCCACGATCGAGAAGCACAAACAGAACAGCGAGACCTTCCGGGCGTTTAACAGTTCCTTTTCCAGAGACGATGAGCATTGCCCCGATTCCCCGGTGCCGGGCACGGGCCCCCCAGATTATTCCTCAGGGATGGACGGCTGCAGCTCTCCTGGAGGGGCCGATTCCTTCCGGAAATCCTGTAAGATAAAGCGGGAGAAGGAGAAGCAAAACTGCAAGGGCTGCGGGGAGAGTTTCAACTCCATAACGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGACAGAGGAGGAGAAGAAGGAATGGATACAGGTCATCCAAGCCACGATCGAGAAGCACAAACAGAACAGCGAGACCTTCCGGGCGTTTAACAGTTCCTTTTCCAGAGACGATGAGCATTGCCCCGATTCCCCGGTGCCGGGCACGGGCCCCCCAGATTATTCCTCAGGGATGGACGGCTGCAGCTCTCCTGGAGGGGCCGATTCCTTCCGGAAATCCTGTAAGATAAAGCGGGAGAAGGAGAAGCAAAACTGCAAGGGCTGCGGGGAGAGTTTCAACTCCATAACGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGTGATTTGCGCAAAGTGCTCGGAGTTCAAGCTGCTGGCGGAGAACAGTCGGCATAACCGGGTCTGTAAGGAGTGTTTCCCTCTCGTCTCCTCTGTCTCGGGGAGTCCGGGGGGCACCACAGAGTCGGGGGACACAAAGAAGAAAGTGGAGAAGCAGAATTCCTTGTCTCCGGAAAACTGTGTGTTCAGCAGTAGCCTCCTGTTCCTGGAGAAGGGGAGAACGTGGACGAAAGTGTGGGTGTCGGTGCCCAGGAACGAGCCCCTCGTCATGTATCTGCAGGGGGGCAGCCAGGATGGGCGGCCCCCCCGGGCAATACCGTTGCCAGGATACGAAGTGGGTTTGCCAAGCGCCGGTGACAAAGTGGACTTGAAACACGTATTTAAACTGTCGCAGTCGCAGCAAGTTCTGTTCTTCGGGGCGGAGGATGAGGATTTGCTGCAGAAGTGGAAGGGGATTCTCAGTAAAGCCTCTCGGGGGGACCCCCCCATTGTGGCAGAGGATCCAGAAAAGCTCTAGAACCTCTTGTGCTCTTGAAGCCGACTGGGAATCTCCACTAGGACCCAGGAGAGACTTTGTCCTGCACGTAACTCGCTGTACACCAGGGGGCGCCAACACGTACCTCTCCGGCTATGGCCGGACTCTTGACTTGCACGGGATGCTGGGAGTTGTTGGCCGTTTGTCCCTGCGTCTGTATC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1
                                               BLH MIN     280      42                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Xt ---- 5e-007     NP_001016121.1 hypothetical protein LOC548875 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 2e-007     NP_569923.2 CG14782-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 1e-007     AAI29701.1 Unknown (protein for MGC:160387) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-008     NP_499183.1 phafin 2 (30.2 kD) (3K921) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 9e-020     XP_785563.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 6e-032     BAE93296.1 zinc finger protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-037     NP_571631.2 faciogenital dysplasia [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - ?? ---- 6e-049     XP_688794.1 PREDICTED: similar to faciogenital dysplasia protein [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 9e-059     NP_032027.2 faciogenital dysplasia homolog [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-059     NP_004454.2 faciogenital dysplasia protein [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 7e-101     XP_414331.2 PREDICTED: hypothetical protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ15839.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------TGA------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Brn2                                  CAAJ732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCATCCAAGCCACGATCGAGAAGCACAAACAGAACAGCGAGACCTTCCGGGCGTTTAACAGTTCCTTTTCCAGAGACGATGAGCATTGCCCCGATTCCCCGGTGCCGGGCACGGGCCCCCCAGATTATTCCTCAGGGATGGACGGCTGCAGCTCTCCTGGAGGGGCCGATTCCTTCCGGAAATCCTGTAAGATAAAGCGGGAGAAGGAGAAGCAAAACTGCAAGGGCTGCGGGGAGAGTTTCAACTCCATAACGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGACAGAGGAGGAGAAGAAGGAATGGATACAGGTCATCCAAGCCACGATCGAGAAGCACAAACAGAACAGCGAGACCTTCCGGGCGTTTAACAGTTCCTTTTCCAGAGACGATGAGCATTGCCCCGATTCCCCGGTGCCGGGCACGGGCCCCCCAGATTATTCCTCAGGGATGGACGGCTGCAGCTCTCCTGGAGGGGCCGATTCCTTCCGGAAATCCTGTAAGATAAAGCGGGAGAAGGAGAAGCAAAACTGCAAGGGCTGCGGGGAGAGTTTCAACTCCATAACGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGTGATTTGCGCAAAGTGCTCGGAGTTCAAGCTGCTGGCGGAGAACAGTCGGCATAACCGGGTCTGTAAGGAGTGTTTCCCTCTCGTCTCCTCTGTCCCGGGGAGTCCGGGGGGCCCCACAGAGTCGGGGGACACAAAGAAGAAAGTGGAGAAGCAGAATTCCTTGTCTCCGGAAAACTGTGTGTTCAGCAGTAGCCTCCTGTTCCTGGAG
  5   1   2       bld Te4       out                       CAAN12056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAGTAGGTCCAGTTGGCCCTGTCTGTTTGCCATAAACCAGGATGTTGCCATAGATGTTGGCTGTAGGGAGAATGAAGGTTTCGGGGTGACGCTGAGCTCTCTTATTGCCTCTGTAGGTGCCGGGCACGGGCCCCCCAGATTATTCCTCAGGGATGGACGGCTGCAGCTCTCCTGGAGGGGCCGATTCCTTCCGGAAATCCTGTAAGATAAAGCGGGAGAAGGAGAAGCAAAACTGCAAGGGCTGCGGGGAGAGTTTCAACTCCATAACGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGTGATTTGCGCAAAGTGCTCGGAGTTCAAGCTGCTGGCGGAGAACAGTCGGCATAACCGGGTCTGTAAGGAGTGTTTCCCTCTCGTCTCCTCTGTCTCGGGGAGTCCGGGGGGCACCACAGAGTCGGGGGACACAAAGAAGAAAGTGGAGAAGCAGAATTCCTTGTCTCCGGAAAACTGTGTGTTCAGCAGTAGCCTCCTGTTCCTGGAGAAGGGGAGAACGTGGACGAAAGTGTGGGTGTCGGTGCCCAGGAACGAGCCCCTCGTCATGTATCTGCAGGGGGGCAGCCAGGATGGGCGGCCCCCCCGGGCAATACCGTTGCCAGGATACGAAGTGGGTTTGCCAAGCGCCGGTGACAAAGTGGACTTGAAACACGTATTTAAACTGTCGCAGTCGCAGCAAGTTCTGTTCTTCGGGGCGGAGGATGAGGATTTGCTGCAGAAGTGGAAGGGGATTCTCAGTNAAGCCTCTCGGGGGGACCCCCCATTGTGGC
  5   1   2      seed Brn2      out                       CAAJ15839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTCCTCAGGGATGGACGGCTGCAGCTCTCCTGGAGGGGCCGATTCCTTCCGGAAATCCTGTAAGATAAAGCGGGAGAAGGAGAAGCAAAACTGCAAGGGCTGCGGGGAGAGTTTCAACTCCATAACGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGTGATTTGCGCAAAGTGCTCGGAGTTCAAGCTGCTGGCGGAGAACAGTCGGCATAACCGGGTCTGTAAGGAGTGTTTCCCTCTCGTCTCCTCTGTCCCGGGGAGTCCGGGGGGCCCCACAGAGTCGGGGGACACAAAGAAGAAAGTGGAGAAGCAGAATTCCTTGTCTCCGGAAAACTGTGTGTTCAGCAGTAGCCTCCTGTTCCTGGAGAAGGGGAGAACGTGGACGAAAGTGTGGGTGTCGGTGCCCAGGAACGAGCCCCTCGTCATGTATCTGCAGGGGGGCAGCCAGGATGGGCGGCCCCCCCGGGCAATACCGTTGCCAGGATACGAAGTGGGTTTGCCAAGCGCCGGTGACAAAGTGGACTTGAAACACGTATTTAAACTGTCGCAGTCGCAGCAAGTTCTGTTCTTCGGGGCGGAGGATGAGGATTTGCTGCAGAAGTGGAAGGGGATTCTCAGTAAAGCCTCTCGGGGGGACCCCCCCATTGTGGCAGAGGATCCAGAAAAGCTCTAGAACCTCTTGTGCTCTTGAAGCCGACTGGGAATCTCCACTAGGACCCAGGAGAGACTTTGTCCTGCACGTAACTCGCTGTACAACAGGGGGCGCCAACACGTACCTCTCCGGCTATGGGCGGACTCTTGACTTGCACGGGATGCTG
  5   1   2       bld Spl2      out                       CBSS1004.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAAGCGCAGGCACCACTGCAAGCAATGCGGCGCCGTGATTTGCGCAAAGTGCTCGGAGTTCAAGCTGCTGGCGGAGAACAGTCGGCATAACCGGGTCTGTAAGGAGTGTTTCCCTCTCGTCTCCTCTGTCTCGGGGAGTCCGGGGGGCACCACAGAGTCGGGGGACACAAAGAAGAAAGTGGAGAAGCAGAATTCCTTGTCTCCGGAAAACTGTGTGTTCAGCAGTAGCCTCCTGTTCCTGGAGAAGGGGAGAACGTGGACGAAAGTGTGGGTGTCGGTGCCCAGGAACGAGCCCCTCGTCATGTATCTGCAGGGGGGCAGCCAGGATGGGCGGCCCCCCCGGGCAATACCGTTGCCAGGATACGAAGTGGGTTTGCCAAGCGCCGGTGACAAAGTGGACTTGAAACACGTATTTAAACTGTCGCAGTCGCAGCAAGTTCTGTTCTTCGGGGCGGAGGATGAGGATTTGCTGCAGAAGTGGAAGGGGATTCTCAGTAAAGCCTCTCGGGGGGACCCCCCCATTGTGGCAGAGGATCCAGAAAAGCTCTAGAACCTCTTGTGCTCTTGAAGCCGACTGGGAATCTCCACTAGGACCCAGGAGAGACTTTGTCCTGCACGTAACTCGCTGTACACCANGNGGCGCCAACACGTACCTCTCCGGCTATGGCCGGACTCTTGACTTGCACGGGATGCTGGGAGTTGTTGGCCGTTTGTCCCTGCGTCTGTATCCGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)