Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD2889.3.5                         94 END     4          57        4                laminin alpha 5; laminin alpha-5 chain [Homo sapiens]
     2   2.0    0Xt7.1-TTbA040k18.5                         15 END     3          42       20                laminin, alpha 5 [Danio rerio]

 This cluster: approximate FL confidence score = 90%

 1012094430 Xt7.1-CABC10645.5 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABC10645.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGCTGGATAAATCCTATCACTTTATCAGCCAGTGCGGAGCCAACAGCTTCCAGAGCAACCCTGCCAATAGCAAGTTCTGCAGAGACGCCGCCATCTCCCTCTCTCTTTTTTATAACAATGGTGCCCAGCCTTGTGACTGCCACGAAGCCGGAGCTTTGGGCACTGCCTGTGAACCCCACGGAGGGCAATGCAACTGCCGGCCCAATGTCATTGGCAGAGACTGCTCCCGCTGTGCCACCGGCTACTGGGGATTCCCCAACTGCAGACCTTGTGACTGTGGCTCTCGGCTCTGCGATGAGGTGACCGGCCAATGTATCTGCCCCCCCCCGCACCATAAAACCAGACTGCGTTGTGTGCCAGCCCCAGGCATTCGGTTGCCATCCTCTGGTTGGCTGTGAGGAGTGCAACTGCTCTCCAACTGGGCTGCAGAACAAGACGGAACCAGGATGCGACATACAGACTGGGCAATGCACATGCATGCCAAACGTTGTGGGCAGGAGGTGTGAGCGGTGCGCCCCTGGGTTCTACGGCTACCCTGCCTGCCGACCCTGCAACTGCAACCGAGATGGGGTGGAGCTGAGCATCTGCGACCCTGTTACTGGACAATGTCATTGCAAGGAGAACGTTGAAGGCCTGACCTGTGACCATTGCCGCTTGGGCACCTTCTACCTGGATGCCGCTAACCCAAAAGGCTGTACCAGATGCTTCTGTTTTGGAGCCACCGATCGCTGCCACACAGCTTCCAAACATCGAGCAGAGTTTAGTGATATGAACGGATGGGTGTTGGTGGGTGGAGACCGACAAGAGGTGGAGATTTCTGTCCGCCCAGAGGAAGGGCTCGTTGATGCCAATCTTGAGGATGTTCCTGATGTCTACCAGGAGTTCTACTGGCACGCGCCTCGTTCATACCTGGGAGACCGGGTTTCATCATATGGTGGATTCCTCCGCTATGAGCTCCATTCCAAAGCAATAAGAGGAGACCAACCCAATATCCCAGTGGAAAGGAGACCAGATATTATTCTGAAGGGCAATCAGATGAGCATTGCACATTTGCAGACCAGATACCCGATGTCAGGAGAACATTACCATGGCCGAATACATTTGGTTGAGGGTAACTTTGTCCATGTTCAGACGTACAACCCCGTGTCACGTGAAGAGCTCATGATGGTGTTGGCCAATCTGGAGCAGCTTCTGATCCGAGCTCTGAACTCGCAGTCGTCTTCCTCCGTGTCACTGCGCAGAGTCTTCCTGGACATTGGCCATGAAAGCAGCGTCGGAGTCCGAGCCCCGGAGGTGGAATTGTGCATGTGTCCGGCTAACTACCTGGGCGATTCCTGTCAGGAATGTGCTCCTGGGTATTACAGGGACACCAAAGGTCTTTTCTTGGGCAAGTGTGTACCATGCAACTGTGGTGGTCACTCCGACCAGTGTTTGCCCGGCACAGGCGCTTGTGTGAAATGCCAGCACAATACAGAAGGGGATCGGTGTGAGAGGTGCAAAGATGGATTTGTGTCGAACGGGAC
                                                  Xt7.1-CHK-1008240177                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATAAATCCTATCACTTTATCAGCCAGTGCGGAGCCAACAGCTTCCAGAGCAACCCTGCCAATAGCAAGTTCTGCAGAGACGCCGCCATCTCCCTCTCTCTTTTTTATAACAATGGTGCCCAGCCTTGTGACTGCCACGAAGCCGGAGCTTTGGGCACTGCCTGTGAACCCCACGGAGGGCAATGCAACTGCCGGCCCAATGTCATTGGCAGAGACTGCTCCCGCTGTGCCACCGGCTACTGGGGATTCCCCAACTGCAGACCTTGTGACTGTGGCTCTCGGCTCTGCGATGAGGTGACCGGCCAATGTATCTGCCCCCCCCCGCACCATAAAACCAGACTGCGTTGTGTGCCAGCCCCAGGCATTCGGTTGCCATCCTCTGGTTGGCTGTGAGGAGTGCAACTGCTCTCCAACTGGGCTGCAGAACAAGACGGAACCAGGATGCGACATACAGACTGGGCAATGCACATGCATGCCAAACGTTGTGGGCAGGAGGTGTGAGCGGTGCGCCCCTGGGTTCTACGGCTACCCTGCCTGCCGACCCTGCAACTGCAACCGAGATGGGGTGGAGCTGAGCATCTGCGACCCTGTTACTGGACAATGTCATTGCAAGGAGAACGTTGAAGGCCTGACCTGTGACCATTGCCGCTTGGGCACCTTCTACCTGGATGCCGCTAACCCAAAAGGCTGTACCAGATGCTTCTGTTTTGGAGCCACCGATCGCTGCCACACAGCTTCCAAACATCGAGCAGAGTTTAGTGATATGAACGGATGGGTGTTGGTGGGTGGAGACCGACAAGAGGTGGAGATTTCTGTCCGCCCAGAGGAAGGGCTCGTTGATGCCAATCTTGAGGATGTTCCTGATGTCTACCAGGAGTTCTACTGGCACGCGCCTCGTTCATACCTGGGAGACCGGGTTTCATCATATGGTGGATTCCTCCGCTATGAGCTCCATTCCAAAGCAATAAGAGGAGACCAACCCAATATCCCAGTGGAAAGGAGACCAGATATTATTCTGAAGGGCAATCAGATGAGCATTGCACATTTGCAGACCAGATACCCGATGTCAGGAGAACATTACCATGGCCGAATACATTTGGTTGAGGGTAACTTTGTCCATGTTCAGACGTACAACCCCGTGTCACGTGAAGAGCTCATGATGGTGTTGGCCAATCTGGAGCAGCTTCTGATCCGAGCTCTGAACTCGCAGTCGTCTTCCTCCGTGTCACTGCGCAGAGTCTTCCTGGACATTGGCCATGAAAGCAGCGTCGGAGTCCGAGCCCCGGAGGTGGAATTGTGCATGTGTCCGGCTAACTACCTGGGCGATTCCTGTCAGGAATGTGCTCCTGGGTATTACAGGGACACCAAAGGTCTTTTCTTGGGCAAGTGTGTACCATGCAACTGTGGTGGTCACTCCGACCAGTGTTTGCCCGGCACAGGCGCTTGTGTGAAATGCCAGCACAATACAGAAGGGGATCGGTGTGAGAGGTGCAAAGATGGATTTGTGTCGAACGGGACAGTGGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN     322     164                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     478      72                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     478      15                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Cs ---- 3e-007     BAB68352.1 netrin [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 1e-008     BAA94302.1 netrin [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bf ---- 6e-011     CAB72422.1 amphinetrin [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 8e-021     AAH84071.1 LOC494988 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 5e-064     AAI27298.1 Unknown (protein for MGC:145717) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN --- ?? ---- 5e-064     NP_001090659.1 laminin, gamma 1 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 1e-074     NP_001023281.1 K08C7.3a [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-111     NP_476617.1 CG10236-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 3e-126     XP_796271.2 PREDICTED: similar to ENSANGP00000010787, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 2e-165     XP_426078.2 PREDICTED: similar to laminin alpha 3 splice variant b1 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 0          NP_001034260.1 laminin, alpha 5 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_005551.3 laminin alpha 5; laminin alpha-5 chain [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          XP_203796.1 laminin, alpha 5 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABC10645.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2      skin Brn2      out                       CAAJ13957.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATTTGTCCCATCCTCCCCAGATGGACAAGCTGTTCCATCCCAGCCGGAGACTCTGCCCCCGACTGCTGTTGATTCCACTAGACTGGTCCATTTGCACCCTGTGCAGTCGGTGGTGGGATACAACGGACAAGTCCAAAGCCCGGGGCGCTATGCATTCATTGTGCACTATTATCAGCCGTCCCACCAAACCTTTGCCATTGAGGTGCGGGTACAAGGCGGGCGCGTCTGGCAAGGTTCAGCCAACGCTACTTTCTGCCCCCACGGTTACGGCTGCCGCAGTTTAGTAGTGTCGGAGAACCAGGTCGTTCTAGACGTGACGGACAACAATTTCTCCGTGACCATACGTGTTCCAGATGGCAGGATTGTCTGGATAGAATACGTGTTGGTAATTCCAGAGGACAGTTACAGTTCCAGTTATCTGGTGGAAGAACCGCTGGATAAATCCTATCACTTTATCAGCCAGTGCGGAGCCAACAGCTTCCAGAGCAACCCTGCCAATAGCAAGTTCTGCAGAGACGCCGCCATCTCCCTCTCTCTTTTTTATAACAATGGTGCCCAGCCTTGTGACTGCCACGAAGCCGGAGCTTTGGGCACTGCCTGTGAACCCCACGGAGGGCAATGCAACTGCCGGCCCAATGTCATTGGCAGAGACTGCTCCCGCTGTGCCACCGGCTATTGGGGATTCCCCAACTGCAGACCTTGTGACTGTGGCTCTCGGCTCTGCGATGAGGTGACCGGCCAATGTATCTGCCCCCCCCGCACCAT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ14535.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGCTGGATAAATCCTATCACTTTATCAGCCAGTGCGGAGCCAACAGCTTCCAGAGCAACCCTGCCAATAGCAAGTTCTGCAGAGACGCCGCCATCTCCCTCTCTCTTTTTTATAACAATGGTGCCCAGCCTTGTGACTGCCACGAAGCCGGAGCTTTGGGCACTGCCTGTGAACCCCACGGAGGGCAATGCAACTGCCGGCCCAATGTCATTGGCAGAGACTGCTCCCGCTGTGCCACCGGCTACTGGGGATTCCCCAACTGCAGACCTTGTGACTGTGGCTCTCGGCTCTGCGATGAGGTGACCGGCCAATGTATCTGCCCCCCCCCGCACCATAAAACCAGACTGCGTTGTGTGCCAGCCCCAGGCATTCGGTTGCCATCCTCTGGTTGGCTGTGAGGAGTGCAACTGCTCTCCAACTGGGCTGCAGAACAAGACGGAACCAGGATGCGACATACAGACTGGGCAATGCACATGCATGCCAAACGTTGTGGGCAGGAGGTGTGAGCGGTGCGCCCCTGGGTTCTACGGCTACCCTGCCTGCCGACCCTGCAACTGCAACCGAGATGGGGTGGAGCTGAGCATCTGCGACCCTGTTACTGGACAATGTCATTGCAAGGAGAACGTTGAAGGCCTGACCTGTGACCATTGCCGCTTGGGCACCTTCTACCTGGATGCCGCTAACCCAAAAGGCTGTACCAGATGCTTCTGTTTTGGAGCCACCGATCGCTGCCACACAGCTTCCAAACATCGAGCAGAGTTTAGTGATATGAACGGATGGGTGTTGGTGGGTGGAGACCGACAAG
  5   1   2   10 seed Fat1 5g3  out                       CABC10645.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGGCATTCGGTTGCCATCCTCTGGTTGGCTGTGAGGAGTGCAACTGCTCTCCAACTGGGCTGCAGAACAAGACGGAACCAGGATGCGACATACAGACTGGGCAATGCACATGCATGCCAAACGTTGTGGGCAGGAGGTGTGAGCGGTGCGCCCCTGGGTTCTACGGCTACCCTGCCTGCCGACCCTGCAACTGCAACCGAGATGGGGTGGAGCTGAGCATCTGCGACCCTGTTACTGGACAATGTCATTGCAAGGAGAACGTTGAAGGCCTGACCTGTGACCATTGCCGCTTGGGCACCTTCTACCTGGATGCCGCTAACCCAAAAGGCTGTACCAGATGCTTCTGTTTTGGAGCCACCGATCGCTGCCACACAGCTTCCAAACATCGAGCAGAGTTTAGTGATATGAACGGATGGGTGTTGGTGGGTGGAGACCGACAAGAGGTGGAGATTTCTGTCCGCCCAGAGGAAGGGCTCGTTGATGCCAATCTTGAGGATGTTCCTGATGTCTACCAGGAGTTCTACTGGCACGCGCCTCGTTCATACCTGGGAGACCGGGTTTCATCATATGGTGGATTCCTCCGCTATGAGCTCCATTCCAAAGCAATAAGAGGAGACCAACCCAATATCCCAGTGGAAAGGAGACCAGATATTATTCTGAAGGGCAATCAGATGAGCATTGCACATTTGCAGACCAGATACCCGATGTCAGGAGAACATTACCATGGCCGAATACATTTGGTTGAGGGTAACTTTGTCCATGTTCAGACGTACAACCCCGTGTCACGTGAAGAGCTCATGATGGTGTTGGCCAATCTGGAGCAGCTTCTGA
  5   1   2       bld Brn2      out                       CAAJ20306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGGAGGTGTGAGCGGTGCGCCCCTGGGTTCTACGGCTACCCTGCCTGCCGACCCTGCAACTGCAACCGAGATGGGGTGGAGCTGAGCATCTGCGACCCTGTTACTGGACAATGTCATTGCAAGGAGAACGTTGAAGGCCTGACCTGTGACCATTGCCGCTTGGGCACCTTCTACCTGGATGCCGCTAACCCAAAAGGCTGTACCAGATGCTTCTGTTTTGGAGCCACCGATCGCTGCCACACAGCTTCCAAACATCGAGCAGAGTTTAGTGATATGAACGGATGGGTGTTGGTGGGTGGAGACCGACAAGAGGTGGAGATTTCTGTCCGCCCAGAGGAAGGGCTCGTTGATGCCAATCTTGAGGATGTTCCTGATGTCTACCAGGAGTTCTACTGGCACGCGCCTCGTTCATACCTGGGAGACCGGACCTTATGGTTTAGTTTCATCATATGGTGGATTCCTCCGCTATGAGCTCCATTCCAAAGCAATAAGAGGAGACCAACCCAATATCCCAGTGGAAAGGAGACCAGATATTATTCTGAAGGGCAATCAGATGAGCATTGCACATTTGCAGACCAGATACCCAATGTCAGGAGAACATTACCATGGCCGAATACATTTGGTTGAGGGTAACTTTGTCCATGTTCAGACGTACAACCCCGTGTCACGTGAAGAGCTCATGATGGTGTTGGCCAATCTGGAGCAGCTTCTGATCCGAGCTCTGAACTCGCAGTCGTCTTCCTCCGTGTCACTGCGCAGAGTCTTCCTGGACATTGGCCATGAAAGCAGCGT
  5   1   2      skin Brn2      out                       CAAJ16487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGATGTCTACCAGGAGTTCTACTGGCACGCGCCTCGTTCATACCTGGGAGACCGGGTTTCATCATATGGTGGATTCCTCCGCTATGAGCTCCATTCCAAAGCAATAAGAGGAGACCAACCCAATATCCCAGTGGAAAGGAGACCAGATATTATTCTGAAGGGCAATCAGATGAGCATTGCACATTTGCAGACCAGATACCCAATGTCAGGAGAACATTACCATGGCCGAATACATTTGGTTGAGGGTAACTTTGTCCATGTTCAGACGTACAACCCCGTGTCACGTGAAGAGCTCATGATGGTGTTGGCCAATCTGGAGCAGCTTCTGATCCGAGCTCTGAACTCGCAGTCGTCTTCCTCCGTGTCACTGCGCAGAGTCTTCCTGGACATTGGCCATGAAAGCAGCGTCGGAGTCCGAGCCCCGGAGGTGGAATTGTGCATGTGTCCGGCTAACTACCTGGGCGATTCCTGTCAGGAATGTGCTCCTGGGTATTACAGGGACACCAAAGGTCTTTTCTTGGGCAAGTGTGTACCATGCAACTGTGGTGGTCACTCCGACCAGTGTTTGCCCGGCACAGGCGCTTGTGTGAAATGCCAGCACAATACAGAAAGGGATCGGTGTGAGAGGTGCAAAGATGGATTTGTGTCGAACGGGACAGTGGA
  5   1   2       bld Brn2      out                       CAAJ20008.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAGGAGACCAACCCAATATCCCAGTGGAAAGGAGACCAGATATTATTCTGAAGGGCAATCAGATGAGCATTGCACATTTGCAGACCAGATACCCGATGTCAGGAGAACATTACCATGGCCGAATACATTTGGTTGAGGGTAACTTTGTCCATGTTCAGACGTACAACCCCGTGTCACGTGAAGAGCTCATGATGGTGTTGGCCAATCTGGAGCAGCTTCTGATCCGAGCTCTGAACTCGCAGTCGTC
  5   1   2      skin Brn2      out                       CAAJ14768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGTCCGAGCCCCGGAGGTGGAATTGTGCATGTGTCCGGCTAACTACCTGGGCGATTCCTGTCAGGAATGTGCTCCTGGGTATTACAGGGACACCAAAGGTCTTTTCTTGGGCAAGTGTGTACCATGCAACTGTGGTGGTCACTCCGACCAGTGTTTGCCCGGCACAGGCGCTTGTGTGAAATGCCAGCACAATACAGAAGGGGATCGGTGTGAGAGGTGCAAAGATGGATTTGTGTCGAACGGGACAGTGGATGGATCCTTGCAGTGCGTGTCCTGCCCCTGTCCCCTGTCAGTGCCGTCCAACAATTTCGCCATTGGATGTTTTCAAAGAGGCTCCACCTTCCAGTGTCTCTGCAGACTGGGCTACGCCGGTGCCAACTGTGAGAGGTGTGCACCAGGTTTCTATGGAAACCCCATGGTGATTGGCAGTTCCTGCAAGCCCTGCGACTGCAACGGGAACACCGATTCCAACATGCTTTTCAGCGACTGCGATCCCCTGTTCGGCACCTGTTCCAGTTGTATGTTTAACACGGCCGGGACGCATTGCGAAGTGTGCGCTCCCGGGTTCTACGGAGATGCAGTGAGAGCCAAAAACTGCACCAGGTGCGACTGCTCGCCGTGTGGAACCCAATCATGTGATTCCAGGACTGGAAGATGTTCCTGCAGACCTGGCGTGACGGGGTCTCGCTGTGACCGCTGTGAGGAAGGGTACTATGGCTACNATGGATGCTCTGGCTGCCACAAATGCTCCTGTGCCGCGGGTTCGGCCAGCGCCAGGTGTGACCCTGTGAGCGGTCAGTGCCTCTGTCTTCCAGGGATTACCGGCGCTCAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)