Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012094437 Xt7.1-CABD13284.5 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD13284.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGTATAGCAAGCTGTATCCCACATCTGACCATGGAAGTCAGTCTTATGAGCAATGGGTTATTCAGACAGATAAGACAGCTGCCAAAGAAGGAAAACGCAAGGAACACGTGTGTGCTGAACATCTAAGGAAGTACAATGACGCCCTGCAGATCAATGACACCATTCGCATGACCGACTCCTTAATACATCTTAGGAAATTTTATGAAGAGGAGAAAAAAAGGAAAATTCTGTTAAACGAGGGTTCAGAGCACGTGGCGCCATTGAACATTGAGGAAACAGACAGATTTCTTATTGACTTATTTTACGACAATGAAAAGGAACTAACTGCAATCGCTAAAAATCCCAAATATGAAAATGAGAATCTATACGCACTCAGGTCATCATTGCTGGAGGAGTTCACCAGGAACGGCCAAGCCAGAGGCATCATCTTCACCAAGACCCGGCAGAGTGCTGTCGCCCTAAACCAGTGGATCAGCGATAATGAGAAATTCACAGAAGTGGGAATTCGATCCAGTTACCTTATTGGAGCAGGACACAACAGTGATTTCAAACCAATGACTCAGAACGAGCAAAAGCAAATCATTCATAAATTCAGCACAGGAGAACTCAATCTACTAGTTGCGACAAGCGTTGCGGAAGAAGGTTTGGATATCAAGGAGTGCAACGTTGTTATTCGATATGGGCTGGTCACAAATGAAATAGCCATGGTGCAGGCACGAGGCCGAGCCAGAGCCGATGATAGCTCCTATGTGTTAGTGGCACCCAGTTCATCGGGAGCTATTGAGCGTGACAGTGTTAATGTGTATAAAGAAGAGATGATGCACAAAGCTATTGCCAAAGTACAAAAGATGGACCGTGCAACTTACATTGACAAGATTGAGGAATTTCAAGCTCAAACCATAATGGAAAAAAAAGTGAAGGCAAAGAAGGCAATTCACAAAGTATATCAGAGTAATCCGTCCCTGGTAACTTTTCACTGCAAGAAGTGCTCCAAGCAAGCCTGCTGTGGAACCGACATTCAGGTCATAGCAACCGCTCATCATGTTAATACAACTCCGAAATTCAAAACTCTCTACAGTAAAGGACCAAATAAAACGCTGCAAGAGAAATTTGCAGATTACCAAATAAATGGTGACATAATTTGCAAAGAATGTGGAAAAACATGGGGGACAACGATGGTACACAAAGGCATTGAAGTACCTTGCCTTCAAATCAGGAACTTTGTTGTTAAATATGATGACAAGAAAATGACTAAGGACACCTACGACAAGTGGAGTGAACTGCCCATCAAGTTCCCGTCTTTTACATATTCTCTGCCTGATAGCGATGAGGATGATGATTAAAAGATTTGTTATTATTTACTATCTTACATTGTATTGGCACGGTCTTCCACCTACTGTCATCAGACAGTTCTGTGTGCCTCTGCTGGAGCATGTCTCAAACATCTAATATATCAATCCATGTTCTAAACATCTAAAATATCAAACCATGTCATGCATAATAAATAAT
                                                  Xt7.1-CHK-1008242496                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAGCAAGCTGTATCCCACATCTGACCATGGAAGTCAGTCTTATGAGCAATGGGTTATTCAGACAGATAAGACAGCTGCCAAAGAAGGAAAACGCAAGGAACACGTGTGTGCTGAACATCTAAGGAAGTACAATGACGCCCTGCAGATCAATGACACCATTCGCATGACCGACTCCTTAATACATCTTAGGAAATTTTATGAAGAGGAGAAAAAAAGGAAAATTCTGTTAAACGAGGGTTCAGAGCACGTGGCGCCATTGAACATTGAGGAAACAGACAGATTTCTTATTGACTTATTTTACGACAATGAAAAGGAACTAACTGCAATCGCTAAAAATCCCAAATATGAAAATGAGAATCTATACGCACTCAGGTCATCATTGCTGGAGGAGTTCACCAGGAACGGCCAAGCCAGAGGCATCATCTTCACCAAGACCCGGCAGAGTGCTGTCGCCCTAAACCAGTGGATCAGCGATAATGAGAAATTCACAGAAGTGGGAATTCGATCCAGTTACCTTATTGGAGCAGGACACAACAGTGATTTCAAACCAATGACTCAGAACGAGCAAAAGCAAATCATTCATAAATTCAGCACAGGAGAACTCAATCTACTAGTTGCGACAAGCGTTGCGGAAGAAGGTTTGGATATCAAGGAGTGCAACGTTGTTATTCGATATGGGCTGGTCACAAATGAAATAGCCATGGTGCAGGCACGAGGCCGAGCCAGAGCCGATGATAGCTCCTATGTGTTAGTGGCACCCAGTTCATCGGGAGCTATTGAGCGTGACAGTGTTAATGTGTATAAAGAAGAGATGATGCACAAAGCTATTGCCAAAGTACAAAAGATGGACCGTGCAACTTACATTGACAAGATTGAGGAATTTCAAGCTCAAACCATAATGGAAAAAAAAGTGAAGGCAAAGAAGGCAATTCACAAAGTATATCAGAGTAATCCGTCCCTGGTAACTTTTCACTGCAAGAAGTGCTCCAAGCAAGCCTGCTGTGGAACCGACATTCAGGTCATAGCAACCGCTCATCATGTTAATACAACTCCGAAATTCAAAACTCTCTACAGTAAAGGACCAAATAAAACGCTGCAAGAGAAATTTGCAGATTACCAAATAAATGGTGACATAATTTGCAAAGAATGTGGAAAAACATGGGGGACAACGATGGTACACAAAGGCATTGAAGTACCTTGCCTTCAAATCAGGAACTTTGTTGTTAAATATGATGACAAGAAAATGACTAAGGACACCTACGACAAGTGGAGTGAACTGCCCATCAAGTTCCCGTCTTTTACATATTCTCTGCCTGATAGCGATGAGGATGATGATTAAAAGATTTGTTATTATTTACTATCTTACATTGTATTGGCACGGTCTTCCACCTACTGTCATCAGACAGTTCTGTGTGCCTCTGCTGGAGCATGTCTCAAACATCTAATATATCAATCCATGTTCTAAACATCTAAAATATCAAACCATGTCATGCATAATAAATAATGAACAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                PROTEIN --- Dm ---- 2e-011     NP_650971.2 CG7922-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PREDICTED - Sc ---- 1e-013     NP_012267.1 Mutator PHenotype; Similar to ATP-dependent RNA helicases; Mph1p [Saccharomycescerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 2e-032     NP_501018.1 Dicer-Related Helicase, a DExH-box helicase (119.2 kD) (drh-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 3e-050     XP_780474.1 PREDICTED: similar to DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide RIG-I [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ---- 2e-086     AAH73528.1 MGC82787 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- ?? ---- 2e-086     NP_001085915.1 MGC82787 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 2e-103     XP_694124.1 PREDICTED: similar to Interferon induced with helicase C domain protein 1 (Helicase with 2 CARD domains) (Helicard) (Melanoma differentiation-associated protein 5) (MDA-5) (RNA helicase-DEAD box protein 116) (Murabutide-down-regulated protein)..., partial  [Danio rerio]  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 4e-151     NP_082111.1 melanoma differentiation associated protein-5 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-156     NP_071451.2 melanoma differentiation associated protein-5 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-159     XP_422031.2 PREDICTED: similar to melanoma differentiation associated protein-5 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABD13284.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATGATG---------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------ATG---TAA------------------------ATG---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Lun1      ?                           CABD574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTATTTGCACGGCCCAGATACTGGAGAATTCTCTCATCCAAGCTGCTGAAGATGAAGAGGAAGGTGTCCAACTGTCTGATTTCTCCCTCATTATTATTGATGAATGCCATCACACTCAAAAGGATGCTGTGTACAATAATATCATGATCCGTTATATAAAAAAGAAAATGCAAAACAAACGCAACAGCAAGATGGAAAAGGCACAGGTTCCACTGCCTCAAATACTTGGACTTACGGCTTCGCCAGGAGTGGGAGGGGCCAAGAACATTAAAAAGTCAGAAGAACATATTCTGAGGATATGCGCAAACATGGATGCTTTCAAAATCATGACCGTGCAAGAAAATGCAGAGCAGCTAAGAAAGCAAGTGAAAGATCCATACAAGGAGGTCAAGATTTCAGATGAAAAGAAGAAGAATCCATTCGGAGACAAATTAAAAGAGATCATGGGAAAGATTGAGGAGTATAGCAAGCTGTATCCCACATCTGACCATGGAAGTCAGTCTTATGAGCAATGGGTTATTCAGACAGATAAGACAGCTGCCAAAGAAGGAAAACGCAAGGAACACGTGTGTGCTGAACATCTAAGGAAGTACAATGACGCCCTGCAGATCAATGACACCATTCGCATGACCGACTCCTTAATACATCTTAGGAAATTTTATGAGGAGGAGAAAAAAAGGAAAATTCTGTTAAACGAGGGTTCAGAGCACGTGGCGCCATTGAACATTGAGGAAACAGACAGATTTCTTATTGACTTATTTTACGACAATGAAAAGGAACTAACTGCAATCGCTAAAAATCCCAAATATGAAAATGAGAATCTATACGCACTCAGGTCATCATTGC
  5   1   2      seed Lun1      in                        CABD13284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGTATAGCAAGCTGTATCCCACATCTGACCATGGAAGTCAGTCTTATGAGCAATGGGTTATTCAGACAGATAAGACAGCTGCCAAAGAAGGAAAACGCAAGGAACACGTGTGTGCTGAACATCTAAGGAAGTACAATGACGCCCTGCAGATCAATGACACCATTCGCATGACCGACTCCTTAATACATCTTAGGAAATTTTATGAAGAGGAGAAAAAAAGGAAAATTCTGTTAAACGAGGGTTCAGAGCACGTGGCGCCATTGAACATTGAGGAAACAGACAGATTTCTTATTGACTTATTTTACGACAATGAAAAGGAACTAACTGCAATCGCTAAAAATCCCAAATATGAAAATGAGAATCTATACGCACTCAGGTCATCATTGCTGGAGGAGTTCACCAGGAACGGCCAAGCCAGAGGCATCATCTTCACCAAGACCCGGCAGAGTGCTGTCGCCCTAAACCAGTGGATCAGCGATAATGAGAAATTCACAGAAGTGGGAATTCGATCCAGTTACCTTATTGGAGCAGGACACAACAGTGATTTCAAACCAATGACTCAGAACGAGCAAAAGCAAATCATTCATAAATTCAGCACAGGAGAACTCAATCTACTAGTTGCGACAAGCGTTGCGGAAGAAGGTTTGGATATCAAGGAGTGCAACGTTGTTATTCGATATGGGCTGGTCACAAATGAAATAGCCATGGTGCAGGCACGAGGCCGAGCCAGAGCCGATGATAGCTCCTATGTGTTAGTGGCACCCAGTTCATCGGGAGCTATTGAGCGTGACAGTGTTAATGTGTATAAAGAAGAGATGATGCACAAAGCTATTGCCAAAGTACAAAAGATGGACCCGTGCACTTACATTGNNACAGATG
  5   1   2       bld Ski1      in                         CABJ7022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGACAGATAAGACAGCTGCCAAAGAAGGAAAACGCAAGGAACACGTGTGTGCTGAACATCTAAGGAAGTACAATGACGCCCTGCAGATCAATGACACCATTCGCATGACCGACTCCTTAATACATCTTAGGAAATTTTATGAAGAGGAGAAAAAAAGGAAAATTCTGTTAAACGAGGGTTCAGAGCACGTGGCGCCATTGAACATTGAGGAAACAGACAGATTTCTTATTGACTTATTTTACGACAATGAAAAGGAACTAACTGCAATCGCTAAAAATCCCAAATATGAAAATGAGAATCTATACGCACTCAGGTCATCATTGCTGGAGGAGTTCACCAGGAACGGCCAAGCCAGAGGCATCATCTTCACCAAGACCCGGCAGAGTGCTGTCGCCCTAAACCAGTGGATCAGCGATAATGAGAAATTCACAGAAGTGGGAATTCGATCCAGTTACCTTATTGGAGCAGGACACAACAGTGATTTCAAACCAATGACTCAGAACGAGCAAAAGCAAATCATTCATAAATTCAGCACAGGAGAACTCAATCTACTAGTTGCGACAAGCGTTGCGGAAGAAGGTTTGGATATCAAGGAGTGCAACGTTGTTATTCGATATGGGCTGGTCACAAATGAAATAGCCATGGTGCAGGCACGAGGCCGAGCCAGAGCCGATGATAGCTCCTATGTGTTAGTGGCACCCAGTTCATCGGGAGCTATTGAGCGTGACAGTGTTAATGTGTATAAAGAAGAGATGATGCACAAAGCTATTGCCAAAGTACAAAAGATGGACCGTGCAACTTACATTGACAAGATTGAGGAATTTTCAGCTCANACCATAATGGA
  3   1   2       bld Ski1      in                         CABJ7022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATATCAAGGAGTGCAACGTTGTTATTCGATATGGGCTGGTCACAAATGANATAGCCATGGTGCAGGCACGAGGCCGAGCCAGAGCCGATGATAGCTCCTATGTGTTAGTGGCACCCAGTTCATCGGGAGCTATTGAGCGTGACAGTGTTAATGTGTATAAAGAAGAGATGATGCACAAAGCTATTGCCAAAGTACAAAAGATGGACCGTGCAACTTACATTGACAAGATTGAGGAATTTCAAGCTCAAACCATAATGGAAAAAAAAGTGAAGGCAAAGAAGGCAATTCACAAAGTATATCAGAGTAATCCGTCCCTGGTAACTTTTCACTGCAAGAAGTGCTCCAAGCAAGCCTGCTGTGGAACCGACATTCAGGTCATAGCAACCGCTCATCATGTTAATACAACTCCGAAATTCAAAACTCTCTACAGTAAAGGACCAAATAAAACGCTGCAAGAGAAATTTGCAGATTACCAAATAAATGGTGACATAATTTGCAAAGAATGTGGAAAAACATGGGGGACAACGATGGTACACAAAGGCATTGAAGTACCTTGCCTTCAAATCAGGAACTTTGTTGTTAAATATGATGACAAGAAAATGACTAAGGACACCTACGACAAGTGGAGTGAACTGCCCATCAAGTTCCCGTCTTTTACATATTCTCTGCCTGATAGCGATGAGGATGATGATTAAAAGATTTGTTATTATTTACTATCTTACATTGTATTGGCACGGTCTTCCACCTACTGTCATCAGACAGTTCTGTGTGCCTCTGCTGGAGCATGTCTCAAACATCTAATATATCAATCCATGTTCTAAACATCTAAAATATCAAACCATGTCATGCATAATAAATAATGAACATT
  3   1   2       bld Lun1      in                        CABD13284.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGATATGGGCTGGTCACAAATGAAATAGCCATGGTGCAGGCACGAGGCCGAGCCAGAGCCGATGATAGCTCCTATGTGTTAGTGGCACCCAGTTCATCGGGAGCTATTGAGCGTGACAGTGTTAATGTGTATAAAGAAGAGATGATGCACAAAGCTATTGCCAAAGTACAAAAGATGGACCGTGCAACTTACATTGACAAGATTGAGGAATTTCAAGCTCAAACCATAATGGAAAAAAAAGTGAAGGCAAAGAAGGCAATTCACAAAGTATATCAGAGTAATCCGTCCCTGGTAACTTTTCACTGCAAGAAGTGCTCCAAGCAAGCCTGCTGTGGAACCGACATTCAGGTCATAGCAACCGCTCATCATGTTAATACAACTCCGAAATTCAAAACTCTCTACAGTAAAGGACCAAATAAAACGCTGCAAGAGAAATTTGCAGATTACCAAATAAATGGTGACATAATTTGCAAAGAATGTGGAAAAACATGGGGGACAACGATGGTACACAAAGGCATTGAAGTACCTTGCCTTCAAATCAGGAACTTTGTTGTTAAATATGATGACAAGAAAATGACTAAGGACACCTACGACAAGTGGAGTGAACTGCCCATCAAGTTCCCGTCTTTTACATATTCTCTGCCTGATAGCGATGAGGATGATGATTAAAAGATTTGTTATTATTTACTATCTTACATTGTATTGGCACGGTCTTCCACCTACTGTCATCAGACAGTTCTGTGTGCCTCTGCTGGAGCATGTCTCAAACATCTAATATATCAATCCATGTTCTAAACATCTAAAATATCAAACCATGTCATGCATAATAAATAATGAACATTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)