Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT57626.3                           31 END     1          33        3                (no blast hit)
     2   2.0    0Xt7.1-XZT37634.5                            6 END     1          33       20                Unknown (protein for MGC:121493) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012094553 Xt7.1-XZT37634.3 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT37634.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTTATCTTATCATTTGAAAACAACGGCGACTATATGGACATGAAACAGGCTGACACCATGCAGTATGTACCCATGCTGGAAATGAAAGAACCCTCCAAGTATTCAGATATCCAGAGATCCTTGTATGACCGGCCTGCGTCGTACAAGAAGAAGCCTTTGTCAGAAGTGAAAAATATCTTGTCTGATGATGGATTCGATGGATTCGATGGTCTAACAGTACTGGACTTGCTCAGTTTCACATATCAAGTTGCAAGGGGCATGGAATTCTTAGCCTCTAAAAATTGTGTACATCGGGATTTGGCAGCTCGGAATGTCCTATTAGCACATGGGAAAATTGTAAAAATCTGTGACTTTGGCCTAGCAAGAGACATCATGCACGACTCCAACTATGTATCCAAAGGCAGCACTTTCCTTCCAGTAAAGTGGATGGCGCCCGAAAGCATCTTCGATAACCTGTACACAACTCTCAGCGATGTGTGGTCATTTGGAATCCTGCTGTGGGAAATATTTTCTCTTGGGGGCACACCGTATCCTGGCATGATTGTGGATTCAACCTTCTATAATAAGATAAAAAGTGGCTACAGAATGGCAAAACCTGACCATGCCACCCATGAAGTGTACGACATCATGGTAAAATGTTGGAACAGTGAACCAGAAAAAAGGCCATCATTTCGCCATCTGAGTGACATTGTGGAAAGTCTACTTCCTATGGAATACAAAAGGTGCTACGAGACAGTTCTTCACGATTTCCTTAAAAGTGACCACCCTGCAGTTACTCGCATGAGAAGTGACAGTGACAATTCCTACATTGGGGTGACGTATAAGAATGAAAACAAAATGAAGGACAGAGAGAGTGGGTTTGATGAGCAAAGGCTGAGCGCTGACAGCGGTTACATTATTCCCCTTCCTGATATTGATCCCGTTTCAGAAGATGAGTCCAGCAAGAGGAACAGGCACAGTTCTCAAACATCAGAAGAAAGTGCAATCGAGACCGGGTCCAGCAGTTCCACTTTTATAAAGAGGGAGGACGAGACCATTGAAGACATTGAGATGATGGACGACATTGGGATCGATTCCTCGGATCTAGTGGAGGACAGTTTCCTGTAAGATCTTGCCGAATCCATTCCACTTGCCAAGCCATTCAAACTAAAGGGAAAGGCTGTGAAATTTCTAGATTTATATTTTT
                                                  Xt7.1-CHK-1008250952                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTTATCATTTGAAAACAACGGCGACTATATGGACATGAAACAGGCTGACACCATGCAGTATGTACCCATGCTGGAAATGAAAGAACCCTCCAAGTATTCAGATATCCAGAGATCCTTGTATGACCGGCCTGCGTCGTACAAGAAGAAGCCTTTGTCAGAAGTGAAAAATATCTTGTCTGATGATGGATTCGATGGATTCGATGGTCTAACAGTACTGGACTTGCTCAGTTTCACATATCAAGTTGCAAGGGGCATGGAATTCTTAGCCTCTAAAAATTGTGTACATCGGGATTTGGCAGCTCGGAATGTCCTATTAGCACATGGGAAAATTGTAAAAATCTGTGACTTTGGCCTAGCAAGAGACATCATGCACGACTCCAACTATGTATCCAAAGGCAGCACTTTCCTTCCAGTAAAGTGGATGGCGCCCGAAAGCATCTTCGATAACCTGTACACAACTCTCAGCGATGTGTGGTCATTTGGAATCCTGCTGTGGGAAATATTTTCTCTTGGGGGCACACCGTATCCTGGCATGATTGTGGATTCAACCTTCTATAATAAGATAAAAAGTGGCTACAGAATGGCAAAACCTGACCATGCCACCCATGAAGTGTACGACATCATGGTAAAATGTTGGAACAGTGAACCAGAAAAAAGGCCATCATTTCGCCATCTGAGTGACATTGTGGAAAGTCTACTTCCTATGGAATACAAAAGGTGCTACGAGACAGTTCTTCACGATTTCCTTAAAAGTGACCACCCTGCAGTTACTCGCATGAGAAGTGACAGTGACAATTCCTACATTGGGGTGACGTATAAGAATGAAAACAAAATGAAGGACAGAGAGAGTGGGTTTGATGAGCAAAGGCTGAGCGCTGACAGCGGTTACATTATTCCCCTTCCTGATATTGATCCCGTTTCAGAAGATGAGTCCAGCAAGAGGAACAGGCACAGTTCTCAAACATCAGAAGAAAGTGCAATCGAGACCGGGTCCAGCAGTTCCACTTTTATAAAGAGGGAGGACGAGACCATTGAAGACATTGAGATGATGGACGACATTGGGATCGATTCCTCGGATCTAGTGGAGGACAGTTTCCTGTAAGATCTTGCCGAATCCATTCCACTTGCCAAGCCATTCAAACTAAAGGGAAAGGCTGTGAAATxTxxAGATTTATxxTxTTTTTTAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2
                                                                       ...PROTEIN --- Sc ---- 5e-015     NP_012440.1 bypass requirement for protein kinase C homolog; Bck1p [Saccharomycescerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 5e-030     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bf ---- 3e-031     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Br ---- 6e-033     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 4e-045     NP_001024723.1 EGg Laying defective family member (egl-15) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-047     NP_995647.1 CG8222-PF, isoform F [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bb ---- 1e-059     BAA84747.1 VEGFR-like [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-059     XP_785024.2 PREDICTED: similar to Fit-1 tyrosine kinase receptor [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 4e-061     BAE06749.1 vascular endothelial growth factor receptor [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 8e-165     NP_571534.1 platelet derived growth factor receptor alpha [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_035188.1 platelet derived growth factor receptor, alpha polypeptide; PDGF alpha chain[Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_006197.1 platelet-derived growth factor receptor alpha precursor [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_990080.1 platelet-derived growth factor receptor alpha [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001080553.1 platelet derived growth factor receptor, alpha polypeptide [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAA49929.1 platelet-derived growth factor A receptor [Xenopus laevis]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI35577.1 Unknown (protein for MGC:121493) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT37634.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---ATG---------------ATG------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld Tad5      out                        XZT25900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTTATCTTATCATTTGAAAACAACGGCGACTATATGGACATGAAACAGGCTGACACCATGCAGTATGTACCCATGCTGGAAATGAAAGAACCCTCCAAGTATTCAGATATCCAGAGATCCTTGTATGACCGGCCTGCGTCGTACAAGAAGAAGCCTTTGTCAGAAGTGAAAAATATCTTGTCTGATGATGGATTCGATGGATTCGATGGTCTAACAGTACTGGACTTGCTCAGTTTCACATATCAAGTTGCAAGGGGCATGGAATTCTTAGCCTCTAAAAATTGTGTACATCGGGATTTGGCAGCTCGGAATGTCCTATTAGCACATGGGAAAATTGTAAAAATCTGTGACTTTGGCCTAGCAAGAGACATCATGCACGACTCCAACTATGTATCCAAAGGCAGCACTTTCCTTCCAGTAAAGTGGATGGCGCCCGAAAGCATCTTCGATAACCTGTACACAACTCTCAGCGATGTGTGGTCATTTGGAATCCTGCTGTGGGAAATATTTTCTCTTGGGGGCACACCGTATCCTGGCATGATTGTGGATTCAACCTTCTATAATAAGATAAAAAGTGGCTACAGAATGGCAAAACCTGACCATGCCACCCATGAAGTGTACGACATCATGGTAAAATGTTGGAACAGTGAACCAGAAAAAAGGCCATCATTTCGCCATCTGAGTGACATTGTGGAAAGTCTACTTCCTATGGAATACAAAAGGTGCTACGAGACAGTTCTTCACGATTTCCTTAAAAGTGACCACCCTGCAGTTACTCGCATGAGAAGTGACAGTGACAATTCCTACATT
  3   1   2      seed Neu  5x3  ?                     TNeu108j08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGTGTACATCGGGATTTGGCAGCTCGGAATGTCCTATTAGCACATGGGAAAATTGTAAAAATCTGTGACTTTGGCCTAGCAAGAGACATCATGCACGACTCCAACTATGTATCCAAAGGCAGCACTTTCCTTCCAGTAAAGTGGATGGCGCCCGAAAGCATCTTCGATAACCTGTACACAACTCTCAGCGATGTGTGGTCATTTGGAATCCTGCTGTGGGAAATATTTTCTCTTGGGGGCACACCGTATCCTGGCATGATTGTGGATTCAACCTTCTATAATAAGATAAAAAGTGGCTACAGAATGGCAAAACCTGACCATGCCACCCATGAAGTGTACGACATCATGGTAAAATGTTGGAACAGTGAACCAGAAAAAAGGCCATCATTTCGCCATCTGAGTGACATTGTGGAAAGTCTACTTCCTATGGAATACAAAAGGTGCTACGAGACAGTTCTTCACGATTTCCTTAAAAGTGACCACCCTGCAGTTACTCGCATGAGAAGTGACAGTGACAATTCCTACATTGGGGTGACGTATAAGAATGAAAACAAAATGAAGGACAGAGAGAGTGGGTTTGATGAGCAAAGGCTGAGCGCTGACAGCGGTTACATTATTCCCCTTCCTGATATTGATCCCGTTTCAGAAGATGAGTCCAGCAAGAGGAACAGGCACAGTTCTCAAACATCAGAAGAAAGTGCAATCGAGACCGGGTCCAGCAGTTCCACTTTTATAAAGAGGGAGGACGAGACCATTGAAGACATTGAGATGATGGACGACATTGGGATCGATTCCTCGGATCTAGTGGAGGACAGTTTCCTGTAAGATCTTGCCGAATCCATTCCACTTGCCAAGCCATTCAAACTAAAGGGAAAGGCTGTGAAATTTCTAGAGATNTTATATTTTTTAACTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 FL   out                        XZT37634.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGTCCTATTAGCACATGGGAAAATTGTAAAAATCTGTGACTTTGGCCTAGCAAGAGACATCATGCACGACTCCAACTATGTATCCAAAGGCAGCACTTTCCTTCCAGTAAAGTGGATGGCGCCCGAAAGCATCTTCGATAACCTGTACACAACTCTCAGCGATGTGTGGTCATTTGGAATCCTGCTGTGGGAAATATTTTCTCTTGGGGGCACACCGTATCCTGGCATGATTGTGGATTCAACCTTCTATAATAAGATAAAAAGTGGCTACAGAATGGCAAAACCTGACCATGCCACCCATGAAGTGTACGACATCATGGTAAAATGTTGGAACAGTGAACCAGAAAAAAGGCCATCATTTCGCCATCTGAGTGACATTGTGGAAAGTCTACTTCCTATGGAATACAAAAGGTGCTACGAGACAGTTCTTCATGATTTCCTTAAAAGTGACCACCCTGCAGTTACTCGCATGAGAAGTGACAGTGACAATTCCTACATTGGGGTGACGTATAAGAATGAAAACAAAATGAAGGACAGAGAGAGTGGGTTTGATGAGCAAAGGCTGAGCGCTGACAGCGGTTACATTATTCCCCTTCCTGATATTGATCCCGTTTCAGAAGATGAGTCCAGCAAGAGGAACAGGCACAGTTCTCAAACATCAGAAGAAAGTGCAATCGAGACCGGGTCCAGCAGTTCCACTTTTATAAAGAGGGAGGACGAGACCATTGAAGACATTGAGATGATGGACGACATTGGGATCGATTCCTCGGATCTAGTGGAGGACAGTTTCCTGTAAGATCTTGCCGAATCCATTCCACTTGCCAAGCCATTCAAACTAAAGGGAAAGGCTGTGAAATCTAGAGATTTATATTTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)