Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xt7.1-CAAK5527.3                           10 END     2          50       20                PREDICTED: similar to cytoplasmic dynein intermediate chain 1 [Gallus gallus]
     2   2.0    0Xt7.1-CABA7312.5                            3 END     1          25       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 297.0    0Xt7.1-CABC9390.5.5                        165 PI      76       1191     1730                Hypothetical protein MGC69267 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012094560 Xt7.1-CAAJ11855.5 - 4 ESTs
                                                                       .-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ11855.5                                                                                                                                                                                                                                                                                                                                                                          CAGAAACAGGAGGAGGAGGAGGAGAAGAGGGATGTCTGATGCTAATAAGCCTGAGCCAAGGCCAGCATGAGACAGCGAATTCACAGGCAGGATCATGCAGTACTCAGTGTGAGCATCCATCCTGCTGTAACACAGAGACTAAAGCACATCTCTTGCCTCTGTCTGCATCCCCACCCCACCCATTCCAGCCCCTGGAGCACCCTATATAAGAGGAGGAAGATTTTGTGATGCCCCCAAAAAAGAGAGTCACCAAAGAGAAAAAAGATCTGAAGAAGCCAGAAAGTGCGGCCCCAGCAGTAAATAGCAGCAGCCAGGACAAAGCAGCCAAGTCTCAGGAGAAGTCAGGTCGGGCTGTGCCATCATCAAGGGTGCATGCTCGGCGCCTTAAAGAGCAAGTAACAGAACCACTACGTGTTTCACAGCCCAGTGTTGCTGCCGCTGTCGCTGCTACTGAGAGTATAGTGCCTGATAGAGCCCAGGAACCAATAATGTCTGACAAAAGTGATTTGAAAGCTGAACTTGAGCGTAAGAAGCAGCGATTGGCACAAATCAGAGAGGAAAAGAAACGGAAGGAGGAGGAAAGGAAAAAGAAAGAGGCGGAACAGCAGCACAAAGCGGAACCTATTGCAGAAGATAGTGATCTGGACCGGAAAAGAAGAGAGACTGAGGCATTACTGCAGAGTATTGGCATATCACCAGAACCACCTCTAGTCCCAACCCCTATGTCTCCCTCTTCGAAATCACTGAGCACCCCCAGCGAGGCGGGCAGTCAGGACTCGGTAGAGGGCACCCTAATGGGACGGACTCTGCAATGGGACACCGACCCTTCAGTATTGCAGCTTCACTCTGACTCAGAACTTGGAAGACGACTTATTAAGCTTGGCGTATCTAAGGTCACTCAAGTCGATTTCTTGCCTCGGGAAGTAGTGTCTTACTCGAAGGAAACGCTGGCGTATCTAAACACCCACCAGACTGAAGAGGAAGAGGAGGATGAGGAAATGGAAGATCTTAACACAGAACATGATTCTGAATTTGAAAATCAAGAGGAGAAGCAAGACTCCAGAGAAGTTCCTCCAAGGGAACTGACAGAGGAGGAAAAACAACAGGTCACCCATTCAGAAGAATTCCTGATCTTTTTTGACCGCACCATTCGTGTGATTGAACGGGCACTGGCAGAGGACTCGAATATATTCTTTGATTACAGTGGAAGAGACCTGGAGGATAAAGAGGGGGACATTCAGGCTGGAGCCAATCTTTCATTTAATCGGCAATTTTATGACGAGCATTGGTCAAAGCATCGTGTGGTTACTTGCCTTGATTGGTCCCTTCAGTACCCAGAGCTGATGGTTGCTTCCTACGATAATAATGAAGATGCCCCTCATGAACCTGATGGAGTTGCATTAGTCTGGAACATGAAATTCGGAAAGACTACTCCAGAGTATATATTCCATTGTCAGTCCTCTGTGATGTCAGTGTGCTTTGCTCGATTTCATCCGAACCTCGTTATTGGTGGAACCTACTCAGGGCAGATTGTTCTTTGGGACAATAGGAGCCACAGGAGAACCCCAGTTCAAAGGACACCACTGTCTGCCGCAGCTCACACTCACCCCATCTACTGTGTTAATGTAGTTGGAACACAAAATGCCCACAACCTTATTACTGTTTCAACTGATGGGAAATTGTGCTCCTGGAGTCTGGATATGCTCTCAGCTCCGCATGAAAGCATGGAGCTTGTCTACA
                                                  Xt7.1-CHK-1008246697                                                                                                                                                                                                                                                                                                                                                                                CAGGAGGAGGAGGAGGAGAAGAGGGATGTCTGATGCTAATAAGCCTGAGCCAAGGCCAGCATGAGACAGCGAATTCACAGGCAGGATCATGCAGTACTCAGTGTGAGCATCCATCCTGCTGTAACACAGAGACTAAAGCACATCTCTTGCCTCTGTCTGCATCCCCACCCCACCCATTCCAGCCCCTGGAGCACCCTATATAAGAGGAGGAAGATTTTGTGATGCCCCCAAAAAAGAGAGTCACCAAAGAGAAAAAAGATCTGAAGAAGCCAGAAAGTGCGGCCCCAGCAGTAAATAGCAGCAGCCAGGACAAAGCAGCCAAGTCTCAGGAGAAGTCAGGTCGGGCTGTGCCATCATCAAGGGTGCATGCTCGGCGCCTTAAAGAGCAAGTAACAGAACCACTACGTGTTTCACAGCCCAGTGTTGCTGCCGCTGTCGCTGCTACTGAGAGTATAGTGCCTGATAGAGCCCAGGAACCAATAATGTCTGACAAAAGTGATTTGAAAGCTGAACTTGAGCGTAAGAAGCAGCGATTGGCACAAATCAGAGAGGAAAAGAAACGGAAGGAGGAGGAAAGGAAAAAGAAAGAGGCGGAACAGCAGCACAAAGCGGAACCTATTGCAGAAGATAGTGATCTGGACCGGAAAAGAAGAGAGACTGAGGCATTACTGCAGAGTATTGGCATATCACCAGAACCACCTCTAGTCCCAACCCCTATGTCTCCCTCTTCGAAATCACTGAGCACCCCCAGCGAGGCGGGCAGTCAGGACTCGGTAGAGGGCACCCTAATGGGACGGACTCTGCAATGGGACACCGACCCTTCAGTATTGCAGCTTCACTCTGACTCAGAACTTGGAAGACGACTTATTAAGCTTGGCGTATCTAAGGTCACTCAAGTCGATTTCTTGCCTCGGGAAGTAGTGTCTTACTCGAAGGAAACGCxxxCxxxxxxxxACACCCACCAGACTGAAGAGGAAGAGGAGGATGAGGAAATGGAAGATCTTAACACAGAACATGATTCTGAATTTGAAAATCAAGAGGAGAAGCAAGACTCCAGAGAAGTTCCTCCAAGGGAACTGACAGAGGAGGAAAAACAACAGGTCACCCATTCAGAAGAATTCCTGATCTTTTTTGACCGCACCATTCGTGTGATTGAACGGGCACTGGCAGAGGACTCGAATATATTCTTTGATTACAGTGGAAGAGACCTGGAGGATAAAGAGGGGGACATTCAGGCTGGAGCCAATCTTTCATTTAATCGGCAATTTTATGACGAGCATTGGTCAAAGCATCGTGTGGTTACTTGCCTTGATTGGTCCCTTCAGTACCCAGAGCTGATGGTTGCTTCCTACGATAATAATGAAGATGCCCCTCATGAACCTGATGGAGTTGCATTAGTCTGGAACATGAAATTCGGAAAGACTACTCCAGAGTATATATTCCATTGTCAGTCCTCTGTGATGTCAGTGTGCTTTGCTCGATTTCATCCGAACCTCGTTATTGGTGGAACCTACTCAGGGCAGATTGTTCTTTGGGACAATAGGAGCCACAGGAGAACCCCAGTTCAAAGGACACCACTGTCTGCCGCAGCTCACACTCACCCCATCTACTGTGTTAATGTAGTTGGAACACAAAATGCCCACAACCTTATTACTGTTTCAACTGATGGGAAATTGTGCTCCTGGAGTCTGGATATGCTCTCAGCTCCGCATGAAAGCATGGAGCTTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                               1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     3     2     2     2     2     1     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     488    1264                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN     467     248                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH OVR     227     142                                                                                                                                                                                                                                                                                                                                                                          
                                               ORF LNG     227     101                                                                                                                                                                                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 4e-014     BAE71138.1 axonemal outer arm dynein intermediate chain 2 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ==== 3e-055     NP_501038.1 cytoplasmic dynein intermediate chain DIC1a (72.0 kD) (4H546) [Caenorhabditiselegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dm ==== 6e-096     NP_477077.1 CG18000-PB, isoform B [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Sp ==== 1e-123     XP_795286.2 PREDICTED: similar to cytoplasmic dynein intermediate chain 2C, partial [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAH68704.1 Unknown (protein for MGC:81132) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xt ==== 0          AAH67997.1 Hypothetical protein MGC69267 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Dr ---- 0          XP_694763.1 PREDICTED: similar to dynein, cytoplasmic, intermediate polypeptide 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = ?? ==== 0          XP_707758.1 PREDICTED: similar to Dncic1 protein isoform 9 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Gg ==== 0          XP_418672.2 PREDICTED: similar to cytoplasmic dynein intermediate chain 1 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_004402.1 dynein, cytoplasmic, intermediate polypeptide 1 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 0          NP_034193.1 dynein, cytoplasmic, intermediate chain 1 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ11855.5                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2      seed Brn2 FL   ?                         CAAJ13657.5p                                                                                                                                                                                                                                                                                                                                                                          CAGAAACAGGAGGAGGAGGAGGAGAAGAGGGATGTCTGATGCTAATAAGCCTGAGCCAAGGCCAGCATGAGACAGCGAATTCACAGGCAGGATCATGCAGTACTCAGTGTGAGCATCCATCCTGCTGTAACACAGAGACTAAAGCACATCTCTTGCCTCTGTCTGCATCCCCACCCCACCCATTCCAGCCCCTGGAGCACCCTATATAAGAGGAGGAAGATTTTGTGATGCCCCCAAAAAAGAGAGTCACCAAAGAGAAAAAAGATCTGAAGAAGCCAGAAAGTGCGGCCCCAGCAGTAAATAGCAGCAGCCAGGACAAAGCAGCCAAGTCTCAGGAGAAGTCAGGTCGGGCTGTGCCATCATCAAGGGTGCATGCTCGGCGCCTTAAAGAGCAAGTAACAGAACCACTACGTGTTTCACAGCCCAGTGTTGCTGCCGCTGTCGCTGCTACTGAGAGTATAGTGCCTGATAGAGCCCAGGAACCAATAATGTCTGACAAAAGTGATTTGAAAGCTGAACTTGAGCGTAAGAAGCAGCGATTGGCACAAATCAGAGAGGAAAAGAAACGGAAGGAGGAGGAAAGGAAAAAGAAAGAGGCGGAACAGCAGCACAAAGCGGAACCTATTGCAGAAGATAGTGATCTGGACCGGAAAAGAAGAGAGACTGAGGCATTACTGCAGAGTATTGGCATATCACCAGAACCACCTCTAGTCCCAACCCCTATGTCTCCCTCTTCGAAATCACTGAGCACCCCCAGCGAGGCGGGCAGTCAGGACTCGGTAGAGGGCACCCTATGGGACGGACTCTGC
  5   1   2   14  bld Brn3 5g3  out                        CAAK5527.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCAGTACTCAGTGTGAGCATCCATCCTGCTGTAACACAGAGACTAAAGCACATCTCTTGCCTCTGTCTGCATCCCCACCCCACCCATTCCAGCCCCTGGAGCACCCTATATAAGAGGAGGAAGATTTTGTGATGCCCCCAAAAAAGAGAGTCACCAAAGAGAAAAAAGATCTGAAGAAGCCAGAAAGTGCGGCCCCAGCAGTAAATAGCAGCAGCCAGGACAAAGCAGCCAAGTCTCAGGAGAAGTCAGGTCGGGCTGTGCCATCATCAAGGGTGCATGCTCGGCGCCTTAAAGAGCAAGTAACAGAACCACTACGTGTTTCACAGCCCAGTGTTGCTGCCGCTGTCGCTGCTACTGAGAGTATAGTGCCTGATAGAGCCCAGGAACCAATAATGTCTGACAAAAGTGATTTGAAAGCTGAACTTGAGCGTAAGAAGCAGCGATTGGCACAAATCAGAGAGGAAAAGAAACGGAAGGAGGAGGAAAGGAAAAAGAAAGAGGCGGAACAGCAGCACAAAGCGGAACCTATTGCAGAAGATAGTGATCTGGACCGGAAAAGAAGAGAGACTGAGGCATTACTGCAGAGTATTGGCATATCACCAGAACCACCTCTAGTGCAGCCATTTTTAACATTGGATACCTGTTATTTTCATTATTTAGTCCCAACCCCTATGTCTCCCTCTTCGAAATCACTGAGCACCCCCAGCGAGGCGGGCAGTCAGGACTCGGTAGAGGGCACCCTAATGGGACGGAATATACAGAGTGGCCTACCTGGGACTCTGCAATGGGACACCGACCCTTCAGTATTGCAGCTTCACTCTGACTCAGAACTTGGAAGACGACTTTATAGCTTGGCGTATCTAAGGT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ11855.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAAAGCACATCTCTTGCCTCTGTCTGCATCCCCACCCCACCCATTCCAGCCCCTGGAGCACCCTATATAAGAGGAGGAAGATTTTGTGATGCCCCCAAAAAAGAGAGTCACCAAAGAGAAAAAAGATCTGAAGAAGCCAGAAAGTGCGGCCCCAGCAGTAAATAGCAGCAGCCAGGACAAAGCAGCCAAGTCTCAGGAGAAGCCAGGTCGGGCTGTGCCATCATCAAGGGTGCATGCTCGGCGCCTTAAAGAGCAAGTAACAGAACCACTACGTGTTTCACAGCCCAGTGTTGCTGCCGCTGTCGCTGCTACTGAGAGTATAGTGCCTGATAGAGCCCAGGAACCAATAATGTCTGACAAAAGTGATTTGAAAGCTGAACTTGAGCGTAAGAAGCAGCGATTGGCACAAATCAGAGAGGAAAAGAAACGGAAGGAGGAGGAAAGGAAAAAGAAAGAGGCGGAACAGCAGCACAAAGCGGAACCTATTGCAGAAGATAGTGATCTGGACCGGAAAAGAAGAGAGACTGAGGCATTACTGCAGAGTATTGGCATATCACCAGAACCACCTCTAGTCCCAACCCCTATGTCTCCCTCTTCGAAATCACTGAGCACCCCCAGCGAGGCGGGCAGTCAGGACTCGGTAGAGGGCACCCTAATGGGACGGACTCTGCAATGGGACACCGACCCTTCAGTATTGCAGCTTCACTCTGACTCAGAACTTGGAAGACGACTTATTAAGCTTGGCGTATCTAAGGTCACTCAAGTCGATTTCTTGCCTCGGGAAGTAGTGTCTTACTCGAAGGAAACGCANACTCCCAGTGACACCCACCAGACTNGAGAGGAAGNNAGAGATGAGGAAATGGTAGATCTTAAAACAGAACATGATTCTGAATTTGAAATTCAGAGGAGAAGCAGAC
  5   1   1       add TbA       out                  TTbA003p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGAAACGCAAACTCCAGTGACAACCCACCAGACTGAAGAGGAAGAGGAGGATGAGGAAATGGAAGATCTTAACACAGAACATGATTCTGAATTTGAAAATCAAGAGGAGAAGCAAGACTCCAGAGAAGTTCCTCCAAGGGAACTGACAGAGGAGGAAAAACAACAGGTCACCCATTCAGAAGAATTCCTGATCTTTTTTGACCGCACCATTCGTGTGATTGAACGGGCACTGGCAGAGGACTCGAATATATTCTTTGATTACAGTGGAAGAGACCTGGAGGATAAAGAGGGGGACATTCAGGCTGGAGCCAATCTTTCATTTAATCGGCAATTTTATGACGAGCATTGGTCAAAGCATCGTGTGGTTACTTGCCTTGATTGGTCCCTTCAGTACCCAGAGCTGATGGTTGCTTCCTACGATAATAATGAAGATGCCCCTCATGAACCTGATGGAGTTGCATTAGTCTGGAACATGAAATTCGGAAAGACTACTCCAGAGTATATATTCCATTGTCAGTCCTCTGTGATGTCAGTGTGCTTTGCTCGATTTCATCCGAACCTCGTTATTGGTGGAACCTACTCAGGGCAGATTGTTCTTTGGGACAATAGGAGCCACAGGAGAACCCCAGTTCAAAGGACACCACTGTCTGCCGCAGCTCACACTCACCCCATCTACTGTGTTAATGTAGTTGGAACACAAAATGCCCACAACCTTATTACTGTTTCAACTGATGGGAAATTGTGCTCCTGGAGTCTGGATATGCTCTCAGCTCCGCATGAAAGCATGGAGCTTGTCTACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)