Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAL5774.5                            2 END     2          50      100                valosin-containing protein (p97)/p47 complex-interacting protein p135 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012094660 Xt7.1-CAAL5774.3 - 4 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 4e-057     XP_001202826.1 PREDICTED: similar to VCP(p97)/p47-interacting protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 4e-149     XP_699171.1 PREDICTED: similar to Deubiquitinating protein VCIP135 (Valosin-containing protein p97/p47 complex-interacting protein p135) [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 2e-166     NP_001012966.1 valosin-containing protein (p97)/p47 complex-interacting protein p135 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 5e-169     NP_775619.2 valosin-containing protein (p97)/p47 complex-interacting protein p135 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-170     NP_079330.2 valosin containing protein (p97)/p47 complex interacting protein 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAL5774.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       bld Gas7      out                        XZG19214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAATATTTGCTGAGGTTGGTTGCTGCAATGGAGGAAGTATTCATGAACAAGCATGGAATCCATCCCAGTTTAGTATCAGATGTTCATCATTATTTTTATAGAAGAACTGGGGTCATTGGGGTTCAGCCTGAAGAAGTGATTGCTGCTGCAAAGAAGGCAGTATTGGAAAACCGCCTCCATAAATGTCTCATTTGCGGGGCACTGTCAGAACTTCTGGTTCCTCCAGAGTGGCTAGCCCCAGGAGGGAAGTTGTATAACTTGGCAAAAACAACCCACGGCCAATTAAAACCAGATAAAAATTATAGTTTTCCTCTTAACAATATTGTTTGCTCTTATGATGCTACAAATGACATTTTGGTACCTGACTATAATTTAAGTAATCTGACCAGTTGCAATTGGTGCCGTGGTACCTCAGTACGGCGAGTAAGAAATGATTCCTCCATTGTCTATCTGGATGGGGACAGAACTAATACAAAATCCTTTGGAGGTAAATGTGGTTGTGGCTTCAAACACTACTGGGATGGCAAGGAATACGATAATTTGCCAGAAGCCTTTCCTATTACACTCGAGTGGGGAGGAAGGGTTGTAAGGGAAACAGTATACTGGTTTCAGTATGAAAGTGATGTGACTTTAAATAGCAATGTATATGATGTTGCTATGAAATTAGTTACTAAGCACTTCCCCTGGGGAATTTGGCAGTGAAATACTGGTACAAAA
  5   1   2       bld Te3                                  CAAM3753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGAATCCCAATGATTATACACCAGTAGCTATAGATGGCAGTATTGGAAAACCGCCTCCATAAATGTCTCATTTGCGGGGCACTGTCAGAACTTCTGGTTCCTCCAGAGTGGTTAGCCCCAGGAGGGAAGTTGTATAACTTGGCAAAAACAACCCACGGTCAACTAAAACCAGATAAAAATTATAGTTTTCCTCTTAACAATATTGTTTGCTCTTATGATGCTGCAAATGACATTTTGGTACCTGACTATAATTTAAGTAATCTGACCAGTTGCAATTGGTGCCGTGGTACCTCAGTACGGCGAGTAAGAAATGATTCCTCCATTGTCTATCTGGATGGGGACAGAACTAATACAAAATCCTTTGGAGGTAAATGTGGTTGTGGCTTCAAACACTACTGGGATGGCAAGGAATACGATAATTTGCCAGAAGCCTTTCCTATTACACTCGAGTGGGGAGGAAGGGTTGTAAGGGAAACAGTATACTGGTTTCAGTATGAAAGTGATGTGACTTTAAATAGCAATGTATATGATGTTGCTATGAAATTAGTTACTAAGCACTTCCCTGGGGAATTTGGCAGTGAAATACTGGTACAAAAAGTTGTAAATACAATATTGCATCAGACTGCCAAAAAGAATCCCAATGATTATACACCAGTAGCTATAGATGGCGCCCATGTCCAAAGAATGGAGGACGTTAAACACGAACAAGAGCCTGAGTCGCATTTGCCGACAAAAAATAATCTTACTGGTCAGAAAGCTAAGACTTTGCATAAAGAGGAGTTAAACATTGAGCAAAACTGAAAGGAAAC
  3   1   2      seed Brn4 PIPE out                        CAAL5774.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTTGCGGGGCACTGTCAGAACTTCTGGTTCCTCCAGAGTGGCTAGCCCCAGGAGGGAAGTTGTATAACTGGGCAAAAACAACCCACGGCCAATTAAAACCAGATAAAAATTATAGTTTTCCTCTTAACAATATTGTTTGCTCTTATGATGCTACAAATGACATTTTGGTACCTGACTATAATTTAAGTAATCTGACCAGTTGCAATTGGTGCCGTGGTACCTCAGTACGGCGAGTAAGAAATGATTCCTCCATTGTCTATCTGGATGGGGACAGAACTAATACAAAATCCTTTGGAGGTAAATGTGGTTGTGGCTTCAAACACTACTGGGATGGCAAGGAATACGATAATTTGCCAGAAGCCTTTCCTATTACACTCGAGTGGGGAGGAAGGGTTGTAAGGGAAACAGTATACTGGTTTCAGTATGAAAGTGATGTGACTTTAAATAGCAATGTATATGATGTTGCTATGAAATTAGTTACTAAGCACTTCCCTGGGGAATTTGGCAGTGAAATACTGGTACAAAAAGTTGTAAATACAATATTGCATCAGACTGCCAAAAAGAATCCCAATGATTATACACCAGTAGCTATAGATGGCGCCCATGTCCAAAGAATGGAGGACGTTAAACACGAACAAGAGCCTGAGTCGCATTTGCCGACAAAAATAATTCTTACTGGTCAGAAAGCTAAGACTTTGCATAAAGAGGAGTTAAACATGAGCAAAACTGAAAGGAAACTGCAGCAAAGCATTACAGAACAAGCAGCTGTAATGCAGAAAAG
  3   1   2       bld Te5       out                        CAAO6973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAAGTTGTATAACTTGGCAAAAACAACCCACGGCCAATTAAAACCAGATAAAAATTATAGTTTTCCTCTTAACAATATGTTNNGCTCTTATGATGCTACAAATGACATTTTGGTACCTGACTATAATTTAAGTAATCTGACCAGTTGCAATTGGTGCCGTGGTACCTCAGTACGGCGAGTAAGAAATGATTCCTCCATTGTCTATCTGGATGGGGACAGAACTAATACAAAATCCTTTGGAGGTAAATGTGGTTGTGGCTTCAAACACTACTGGGATGGCAAGGAATACGATAATTTGCCAGAAGCCTTTCCTATTACACTCGAGTGGGGAGGAAGGGTTGTAAGGGAAACAGTATACTGGTTTCAGTATGAAAGTGATGTGACTTTAAATAGCAATGTATATGATGTTGCTATGAAATTAGTTACTAAGCACTTCCCTGGGGAATTTGGCAGTGAAATACTGGTACAAAAAGTTGTAAATACAATATTGCATCAGACTGCCAAAAAGAATCCCAATGATTATACACCAGTAGCTATAGATGGCGCCCATGTCCAAAGAATGGAGGACGTTAAACACGAACAAGAGCCTGAGTCGCATTTGCCGACAAAAATAATTCTTACTGGTCAGAAAGCTAAGACTTTGCATAAAGAGGAGTTAAACATGAGCAAAACTGAAAGGAAACTGCAGCAAAGCATTACAGAACAAGCAGCTGTAATGCAGAAAAGGAAAACAGAAAAAAATCAAGCAAGAACAGATAGGACCAACACGGTCTTCATCCCCTGGAGCTGCCAGAGAGAGCCCACCATCAGGCCCATCAACACCAACAAAAACTCCCTACTCTCCAACCGCTTCT

In case of problems mail me! (