Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA027b22.5                          5 END     2          66       50                homeodomain protein [Xenopus laevis]
     2   2.0    0Xt7.1-CAAN11134.3                           2 END     1          33       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012094708 Xt7.1-CAAN11134.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAN11134.5 AGCGATGCAATCGCATGTCAATGTCTTGTTCCTCCAGCTGTTGTAGAACTACACTTTCCAGCTTGCATTACTAGAGGGAATGCTGGGAAGTGTAAAAACACAAAAGATTTAGGGACAGGATTCTGACAAACAGATGCATTACACAACTAAAAAAAAATCCCATCTTTATACTGTAAATTGAAAATTGCCCACAAATATGTATTTTCTCCAATAAATATTTAGGGAATTTTACAAAATCTTCATCTAAAAATTGCACTGCATTACGGGTGGGGTCTGTCTTTTTTCCTACTGAATCTGTACATCGACGATGGTTGTATTTATTTATTACATTGATTCAAGCAAATTAAACCATTTTTTTTAAAAAGGCACAACAAAAATTGTAGATATTAGTTGGATGTTAAGAGGTATGCTTTCTATTTTCTGTGTCCTTTTCAGCCCTGTAACGTGGCAGTTGTATAGTGTTAATATAAGTACAAATTGTCTCCAGTTGTTGGAAGTAAGTCATGCCGAACCCTCTAGTCTGCTTTGTGTCTAATGAGAAAAAATATAAGGATTTTATGGGTTCAATTCGTTTGTCTGTTTGTTTGTTCGTTTGTTTGTTTCCTTGTTTCGTTCAATGAAGCTGGATTTCACAACAAAACATACCTTTCTATTTTTGTTACACTCTGCATGTTGTCTATTTCTTCCCGTTAGAAATGGTGGGGGGCAGAATATCCATAAATTATGTTCTGGACTAAAGTTATTTATATGTTGTTATAATGAATGCTTCTATTTAATGAATCCCATTTTTTTTTACATGTGCATTTCGCTTTGATTTTTGGGTTTTTTTCTTCTCCAAAATTGTGCCATTAAAAGTGATTGTTGGATAATAAAAATGAAAAATGTAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008249593       GCAATCGCATGTCAATGTCTTGTTCCTCCAGCTGTTGTAGAACTACACTTTCCAGCTTGCATTACTAGAGGGAATGCTGGGAAGTGTAAAAACACAAAAGATTTAGGGACAGGATTCTGACAAACAGATGCATTACACAACTAAAAAAAAATCCCATCTTTATACTGTAAATTGAAAATTGCCCACAAATATGTATTTTCTCCAATAAATATTTAGGGAATTTTACAAAATCTTCATCTAAAAATTGCACTGCATTACGGGTGGGGTCTGTCTTTTTTCCTACTGAATCTGTACATCGACGATGGTTGTATTTATTTATTACATTGATTCAAGCAAATTAAACCATTTTTTTTAAAAAGGCACAACAAAAATTGTAGATATTAGTTGGATGTTAAGAGGTATGCTTTCTATTTTCTGTGTCCTTTTCAGCCCTGTAACGTGGCAGTTGTATAGTGTTAATATAAGTACAAATTGTCTCCAGTTGTTGGAAGTAAGTCATGCCGAACCCTCTAGTCTGCTTTGTGTCTAATGAGAAAAAATATAAGGATTTTATGGGTTCAATTCGTTTGTCTGTTTGTTTGTTCGTTTGTTTGTTTCCTTGTTTCGTTCAATGAAGCTGGATTTCACAACAAAACATACCTTTCTATTTTTGTTACACTCTGCATGTTGTCTATTTCTTCCCGTTAGAAATGGTGGGGGGCAGAATATCCATAAATTATGTTCTGGACTAAAGTTATTTATATGTTGTTATAATGAATGCTTCTATTTAATGAATCCCATTTTTTTTTACATGTGCATTTCGCTTTGATTTTTGGGTTTTTTTCTTCTCCAAAATTGTGCCATTAAAACTGATTGTTGxxxAxxAAAAATGAAAAATGTAAAAAAAAA
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     3     3     2     3     1     2     1     2     1     2     1     2     2     2
                                                     Xt7.1-CAAN11134.5     ATG------------------------------------TAG---------------------------------ATG---------------------------TAG---------------------ATG------------------------------------------TGA---------------ATG------------TAA------------------------------TAA------------------------------------------TGA---------------ATG------------------------------------------------TAA---------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------TAATGA---------TAA------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------TGA------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                              ]
  5  -1   2       bld Te4       out                       CAAN11134.5p AGCGATGCAATCGCATGTCAATGTCTTGTTCCTCCAGCTGTTGTAGAACTACACTTTCCAGCTTGCATTACTAGAGGGAATGCTGGGAAGTGTAAAAACACAAAAGATTTAGGGACAGGATTCTGACAAACAGATGCATTACACAACTAAAAAAAAATCCCATCTTTATACTGTAAATTGAAAATTGCCCACAAATATGTATTTTCTCCAATAAATATTTAGGGAATTTTACAAAATCTTCATCTAAAAATTGCACTGCATTACGGGTGGGGTCTGTCTTTTTTCCTACTGAATCTGTACATCGACGATGGTTGTATTTATTTATTACATTGATTCAAGCAAATTAAACCATTTTTTTTAAAAAGGCACAACAAAAATTGTAGATATTAGTTGGATGTTAAGAGGTATGCTTTCTATTTTCTGTGTCCTTTTCAGCCCTGTAACGTGGCAGTTGTATAGTGTTAATATAAGTACAAATTGTCTCCAGTTGTTGGAAGTAAGTCATGCCGAACCCTCTAGTCTGCTTTGTGTCTAATGAGAAAAAATATAAGGATTTTATGGGTTCAATTCGTTTGTCTGTTTGTTTGTTCGTTTGTTTGTTTCCTTGTTTCGTTCAATGAAGCTGGATTTCACAACAAAACATACCTTTCTATTTTTGTTACACTCTGCATGTTGTCTATTTCTTCCCGTTAGAAATGGTGGGGGGCAGAATATCCATAAATTATGTTCTGGACTAAAGTTATTTATATGTTGTTATAATGAATGCTTCTATTTAATGAATCCCATTTTTTTTTACATGTGCATTTCGCTTTGATTTTTGGGTTTTTTTCTTCTCCAAAATTGTG
  3   1   2      seed TpA  5g3  out                   TTpA027b22.q1kT7                                                          CCAGCTTGCATTACTAGAGGGAATGCTGGGAAGTGTAAAAACACAAAAGATTTAGGGACAGGATTCTGACAAACAGATGCATTACACAACTAAAAAAAAATCCCATCTTTATACTGTAAATTGAAAATTGCCCACAAATATGTATTTTCTCCAATAAATATTTAGGGAATTTTACAAAATCTTCATCTAAAAATTGCACTGCATTACGGGTGGGGTCTGTCTTTTTTCCTACTGAATCTGTACATCGACGATGGTTGTATTTATTTATTACATTGATTCAAGCAAATTAAACCATTTTTTTTAAAAAGGCACAACAAAAATTGTAGATATTAGTTGGATGTTAAGAGGTATGCTTTCTATTTTCTGTGTCCTTTTCAGCCCTGTAACGTGGCAGTTGTATAGTGTTAATATAAGTACAAATTGTCTCCAGTTGTTGGAAGTAAGTCATGCCGAACCCTCTAGTCTGCTTTGTGTCTAATGAGAAAAAATATAAGGATTTTATGGGTTCAATTCGTTTGTCTGTTTGTTTGTTCGTTTGTTTGTTTCCTTGTTTCGTTCAATGAAGCTGGATTTCACAACAAAACATACCTTTCTATTTTTGTTACACTCTGCATGTTGTCTATTTCTTCCCGTTAGAAATGGTGGGGGGCAGAATATCCATAAATTATGTTCTGGACTAAAGTTATTTATATGTTGTTATAATGAATGCTTCTATTTAATGAATCCCATTTTTTTTTACATGTGCATTTCGCTTTGATTTTTGGGTTTTTTTCTTCTCCAAAATTGTGCCATTAAAACTGATNTGTTGATAATAAAAATGAAAAATGTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  FL   out                   THdA003a14.q1kT7                                                                                                                                                       AAAAAAATCCCATCTTATTTCTGTAAATTGAAAATTGCCCACAAATATGTATTTTCTCCAATAAATATTTAGGGAATTTTACAAAATCTTCATCTAAAAATTGCACTGCATTACGGGTGGGGTCTGTCTTTTTTCCTACTGAATCTGTACATCGACGATGGTTGTATTTATTTATTACATTGATTCAAGCAAATTAAACCATTTTTTTTAAAAAGGCACAACAAAAATTGTAGATATTAGTTGGATGTTAAGAGGTATGCTTTCTATTTTCTGTGTCCTTTTCAGCCCTGTAACGTGGCAGTTGTATAGTGTTAATATAAGTACAAATTGTCTCCAGTTGTTGGAAGTAAGTCATGCCGAACCCTCTAGTTTGCTTTGTGTTTAATGAGAAAAAATATAAGGATTTTATGGGTTCAATTCGTTTGTCTGTTTGTTTGTTCGTTTGTTTGTTTCCTTGTTTCGTTCAATGAAGCTGGATTTCACAACAAAACATACCTTTTTATTTTTGTTACACTCTGCATGTTGTCTATTTCTTCCCGTTAGAAATGGTGGGGGGCAGAATATCCATAAATTATGTTCTGGACTAAAGTTATTTATATGTTGTTATAATGAATGCTTCTATTTAATGAATCCCATTTTTTTTACATGTGCATTTCGCTTTGATTTTTGGGTTTTTTTCTTCTCCAAAATTGTGCCATTAAAAAGTGATTGTTGATAATAAAAATGAAAAATGTAAAAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)