Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ17893.3                           5 END     3         100       60                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012094932 Xt7.1-CAAJ12701.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ12701.5 CCTTCGCAGTGATCGTTTGTCTGGATGTAAATACCAACTATGTGATCCTGCATGTGGTGCAGCCCAAAGCTGTGGGTGTGTATTACAAGCGTTACGTGTGGTTGGCTAGAAAGGCTGTGAGTGCTGATTATTTTTATATCTGTGTATAATACTGTTAAGAAAGTCTTGGCCACTTCACAGACATCCAGAGTGGAGATGTGCTAACCTGTCAGCCATGGACTATCAGATCCGAAGATACCAGGAATAGCCACCTATCAAGAACACATTACCAACCAAAAACATCTATCTCGGATCTCCTGTACTACTAGTCAGAGCATCACTTCAAGCCAGCTAGGAATCCCAAAGATCTTTCTAGAGCTGGCCACAAATCTAGCAAGGACCACCTAAACAATATAAGTCAAGACCTTTAGCATATCTACTCAGTGCCATCAACGCATTTTGCCAGAACCAGAGGACCCAACACTCCAGGGCAACCTTGATAGTTATTAAGTACCAACTACTTTTGCAAGAAGAAGCACCCATCTGTTAAGACAGACCAACAGTGTGAAGAAACTAGCACAAAACAGCAGCGCCTGGGAACTGACAGACTTGATCACCTCAGGAGCTAGGACCCTATCTACACAGATTTCTTCTTCCAGTCTCTTGCATCTTAAAGAACACAAAGAATGTGGCTTTTTGAGAGAATCCGTGGCACTGTAGACCACAGTAGTGGGCGCCAAGCAGGAGATTCAGCCGACAAGCAGGCTAAGGGTGGATCCTACAGCAATGTGCTGACTCCAGACAAGATCCCAGACTTCTTTATTCCTCCCAAACTCAGTAGTGTCCCAGCAGAGGGTGGAGGGGCAGAGGGAGTTTCATCAGGAGATGGGACTTCTTCTAAACCTAACCTGGGGTCATCTGCTTCTGAACAGAACCTTTCAAGCCGACGCCCTCAGCGCAGTCCCCGTCTTCCTACGAAAGCTGCTTCAGAGAGCCGCAATCTACTAAAAGCTGCCAACCGCCACATTATTCAAATAGAGAGTGCAGATGAGTGGGCATCAGAAGAGGACCTAGGCACAAATGCAGATCCTCAGTCCCAGACAGCCATGTCTCTTCCATATGTTCCCAAAGCACAGACATCATATGGTTTTGTAACTCTAATGGAAAGTCCACACACCCGTCGAAAGGAGTCCCTCTTTCACAGTGAGCAAGGATCACTCTCACCCTGCCCATCTCAGTCAAGTTCTCCTAGTTCTCAAAGACGGAGTGGAACAGATGGGGGTGGGGGATCCCAGCTAAATACTTCAGAATTTGGCATGTCTTTGATGAATCCCTACCGCTATTTCAGTGGAG
                                                  Xt7.1-CHK-1008247270       CAGTGATCGTTTGTCTGGATGTAAATACCAACTATGTGATCCTGCATGTGGTGCAGCCCAAAGCTGTGGGTGTGTATTACAAGCGTTACGTGTGGTTGGCTAGAAAGGCTGTGAGTGCTGATTATTTTTATATCTGTGTATAATACTGTTAAGAAAGTCTTGGCCACTTCACAGACATCCAGAGTGGAGATGTGCTAACCTGTCAGCCATGGACTATCAGATCCGAAGATACCAGGAATAGCCACCTATCAAGAACACATTACCAACCAAAAACATCTATCTCGGATCTCCTGTACTACTAGTCAGAGCATCACTTCAAGCCAGCTAGGAATCCCAAAGATCTTTCTAGAGCTGGCCACAAATCTAGCAAGGACCACCTAAACAATATAAGTCAAGACCTTTAGCATATCTACTCAGTGCCATCAACGCATTTTGCCAGAACCAGAGGACCCAACACTCCAGGGCAACCTTGATAGTTATTAAGTACCAACTACTTTTGCAAGAAGAAGCACCCATCTGTTAAGACAGACCAACAGTGTGAAGAAACTAGCACAAAACAGCAGCGCCTGGGAACTGACAGACTTGATCACCTCAGGAGCTAGGACCCTATCTACACAGATTTCTTCTTCCAGTCTCTTGCATCTTAAAGAACACAAAGAATGTGGCTTTTTGAGAGAATCCGTGGCACTGTAGACCACAGTAGTGGGCGCCAAGCAGGAGATTCAGCCGACAAGCAGGCTAAGGGTGGATCCTACAGCAATGTGCTGACTCCAGACAAGATCCCAGACTTCTTTATTCCTCCCAAACTCAGTAGTGTCCCAGCAGAGGGTGGAGGGGCAGAGGGAGTTTCATCAGGAGATGGGACTTCTTCTAAACCTAACCTGGGGTCATCTGCTTCTGAACAGAACCTTTCAAGCCGACGCCCTCAGCGCAGTCCCCGTCTTCCTACGAAAGCTGCTTCAGAGAGCCGCAATCTACTAAAAGCTGCCAACCGCCACATTATTCAAATAGAGAGTGCAGATGAGTGGGCATCAGAAGAGGACCTAGGCACAAATGCAGATCCTCAGTCCCAGACAGCCATGTCTCTTCCATATGTTCCCAAAGCACAGACATCATATGGTTTTGTAACTCTAATGGAAAGTCCACACACCCGTCGAAAGGAGTCCCTCTTTCACAGTGAGCAAGGATCACTCTCACCCTGCCCATCTCAGTCAAGTTCTCCTAGTTCTCAAAGACGGAGTGGAACAGATGGGGGTGGGGGATCCCAGCTAAATACTTCAGAATTTGGCATGTCTTTGATGAATCCCTACCGCTATTTCAGTGGAGGTGAGA
                                                      consensus depths      1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     653      33 
                                               BLH MPR     329      33 
                                               BLH OVR     665     159 
                                               ORF LNG     665      33 
                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - ?? ---- 1e-051     XP_697197.1 PREDICTED: similar to nuclear localized factor 2 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Dr ---- 3e-054     XP_685829.1 PREDICTED: similar to nuclear localized factor 2 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Hs ---- 2e-060     XP_065166.4 PREDICTED: similar to nuclear localized factor 2 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Mm ==== 2e-062     NP_941016.2 hypothetical LOC237397 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Gg ==== 1e-063     XP_425894.2 PREDICTED: similar to RIKEN cDNA 4932409I22 gene [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ12701.5                                                                                                                                                   TAA------TAA---------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TGATAG---------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------TAA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2   14 seed Brn2 5g3  out                       CAAJ20383.5p CCTTCGCAGTGATCGTTTGTCTGGATGTAAATACCAACTATGTGATCCTGCATGTGGTGCAGCCCAAAGCTGTGGGTGTGTATTACAAGCGTTACGTGTGGTTGGCTAGAAAGGCTGTGAGTGCTGATTATTTTTATATCTGTGTATAATACTGTTAAGAAAGTCTTGGCCACTTCACAGACATCCAGAGTGGAGATGTGCTAACCTGTCAGCCATGGACTATCAGATCCGAAGATACCAGGAATAGCCACCTATCAAGAACACATTACCAACCAAAAACATCTATCTCGGATCTCCTGTACTACTAGTCAGAGCATCACTTCAAGCCAGCTAGGAATCCCAAAGATCTTTCTAGAGCTGGCCACAAATCTAGCAAGGACCACCTAAACAATATAAGTCAAGACCTTTAGCATATCTACTCAGTGCCATCAACGCATTTTGCCAGAACCAGAGGACCCAACACTCCAGGGCAACCTTGATAGTTATTAAGTACCAACTACTTTTGCAAGAAGAAGCACCCATCTGTTAAGACAGACCAACAGTGTGAAGAAACTAGCACAAAACAGCAGCGCCTGGGAACTGACAGACTTGATCACCTCAGGAGCTAGGACCCTATCTACACAGATTTCTTCTTCCAGTCTCTTGCATCTTAAAGAACACAAAGAATGTGGCTTTTTGAGAGAATCCGTGGCACTGTAGACCACAGTAGTGGGCGCCAAGCAGGAGATTCAGCCGACAAGCAGGCTAAGGGTGGATCCTACAGCAATGTGCTGACTCCAGACAAGATCCCAGACTTCTTTATTCCTCCCAAACTCAGTAGTGTCC
  5   1   2   14  bld Brn2 PIPE out                       CAAJ12701.5p ..................................CAACTATGTGATCCTGCATGTGGTGCAGCCCAAAGCTGTGGGTGTGTATTACAAGCGTTACGTGTGGTTGGCTAGAAAGGCTGTGAGTGCTGATTATTTTTATATCTGTGTATAATACTGTTAAGAAAGTCTTGGCCACTTCACAGACATCCAGAGTGGAGATGTGCTAACCTGTCAGCCATGGACTATCAGATCCGAAGATACCAGGAATAGCCACCTATCAAGAACACATTACCAACCAAAAACATCTATCTCGGATCTCCTGTACTACTAGTCAGAGCATCACTTCAAGCCAGCTAGGAATCCCAAAGATCTTTCTAGAGCTGGCCACAAATCTAGCAAGGACCACCTAAACAATATAAGTCAAGACCTTTAGCATATCTACTCAGTGCCATCAACGCATTTTGCCAGAACCAGAGGACCCAACACTCCAGGGCAACCTTGATAGTTATTAAGTACCAACTACTTTTGCAAGAAGAAGCACCCATCTGTTAAGACAGACCAACAGTGTGAAGAAACTAGCACAAAACAGCAGCGCCTGGGAACTGACAGACTTGATCACCTCAGGAGCTAGGACCCTATCTACACAGATTTCTTCTTCCAGTCTCTTGCATCTTAAAGAACACAAAGAATGTGGCTTTTTGAGAGAATCCGTGGCACTGTAGACCACAGTAGTGGGCGCCAAGCAGGAGATTCAGCCGACAAGCAGGCTAAGGGTGGATCCTACAGCAATGTGCTGACTCCAGACAAGATCCCAGACTTCTTTATTCCTCCCAAACTCAGTAGTGTCCCAGCAGAGGGTGGAGGGGCAGAGGGAGTTTCATCANGAGATGGGACTTCTTCTAACCCTAACTGGGGTCATCTGCTTCTGAACAGAAACTTTTCAGCC
  5   1   2   14  bld Brn2 5g3  out                       CAAJ17893.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCACCTTTTTTCATTTATACACTGTGTGAAGAAACTAGCACAAAACAGCAGCGCCTGGGAACTGACAGACTTGATCACCTCAGGAGCTAGGACCCTATCTACACAGATTTCTTCTTCCAGTCTCTTGCATCTTAAAGAACACAAAGAATGTGGCTTTTTGAGAGAATCCGTGGCACTGTAGACCACAGTAGTGGGCGCCAAGCAGGAGATTCAGCCGACAAGCAGGCTAAGGGTGGATCCTACAGCAATGTGCTGACTCCAGACAAGATCCCAGACTTCTTTATTCCTCCCAAACTCAGTAGTGTCCCAGCAGAGGGTGGAGGGGCAGAGGGAGTTTCATCAGGAGATGGGACTTCTTCTAAACCTAACCTGGGGTCATCTGCTTCTGAACAGAACCTTTCAAGCCGACGCCCTCAGCGCAGTCCCCGTCTTCCTACGAAAGCTGCTTCAGAGAGCCGCAATCTACTAAAAGCTGCCAACCGCCACATTATTCAAATAGAGAGTGCAGATGAGTGGGCATCAGAAGAGGACCTAGGCACAAATGCAGATCCTCAGTCCCAGACAGCCATGTCTCTTCCATATGTTCCCAAAGCACAGACATCATATGGTTTTGTAACTCTAATGGAAAGTCCACACACCCGTCGAAAGGAGTCCCTCTTTCACAGTGAGCAAGGATCACTCTCACCCTGCCCATCTCAGTCAAGTTCTCCTAGTTCTCAAAGACGGAGTGGAACAGATGGGGGTGGGGGATCCCAGCTAAATACTTCAGAATTTGGCATGTCTTTGATGAATCCCTACCGCTATTTCAGTGGAGGTGAGAGTGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)