Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK8228.3                            8 END     3         100       37                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012094976 Xt7.1-CAAK3224.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK3224.5 CTGCTCTGCCAGGGACACTACAACTGCACTGGCACTCTCACTGCTGGAAGCAATGCCAACATGTGCCTGCTAAGCCTACCCTTGGGATGCAGCTAGAGACGCGCCTCAGAGCTGCCAGGGACATCTAAAGAGCTGTTTGTTCCCCCACTATAACAATAATAATAATAATTCAGATTTGCTTGAATTGACCCTGGGGGCACTCGGTGAGACCATGGCTGCCAAAGCGGTAGATAAACTCCCAGTGACTTTTGGTAGTTTTGTGCATCAGTTCCCAGAAGGCATCTACCCCGGGGAGGATTCCACCCTGCCTGCCTCTGTGACCATCTTCCCTAATGTGGACCTGGGGGGACCCTTTGATCAGATGAACAGTGTGACAGGAGATGGAATGATCAGTGTGGATATGAATAATGAGAAGCGATCGCTGGATTTCTCCTACTCGTCCAACTACCCCTCTGCCCCCCGCAGCCAGCCCTTAGCCTATATGGGCAAGTTCTCCTTTGACCCCCAGTACCCCGGGGCCGGCTGGAATACAGAGGGAATCTTCAATATAGTGAGTGCTGCTAGCATCCTGGGGGTGCCCCCCTCCTCATCTTCCTCCACCACCTCCTCTAACGCCTCATCGGGGTCCCCCAACCTGAGTTGCAGCATGGCTCATCCCCAGAGTGACATGGACCATATCTACTCACCTCCCCCCTACTCCAGCTGCAATGAGATCTACCAGGACCCCTCGGCTTTCATTGGCACCTCCACAGGGGCACCCTACCCGCCCCCTTCCTACCCTTCTCCTAAGGGGGCGTCGGATGGGAGCGTCTTCCCCATGATCCCGGACTACTNCGCTCTCTTTCCTCCCCAATGCCAAAGAGACTTGCACTCCAT
                                                  Xt7.1-CHK-1008248587       TGCCAGGGACACTACAACTGCACTGGCACTCTCACTGCTGGAAGCAATGCCAACATGTGCCTGCTAAGCCTACCCTTGGGATGCAGCTAGAGACGCGCCTCAGAGCTGCCAGGGACATCTAAAGAGCTGTTTGTTCCCCCACTATAACAATAATAATAATAATTCAGATTTGCTTGAATTGACCCTGGGGGCACTCGGTGAGACCATGGCTGCCAAAGCGGTAGATAAACTCCCAGTGACTTTTGGTAGTTTTGTGCATCAGTTCCCAGAAGGCATCTACCCCGGGGAGGATTCCACCCTGCCTGCCTCTGTGACCATCTTCCCTAATGTGGACCTGGGGGGACCCTTTGATCAGATGAACAGTGTGACAGGAGATGGAATGATCAGTGTGGATATGAATAATGAGAAGCGATCGCTGGATTTCTCCTACTCGTCCAACTACCCCTCTGCCCCCCGCAGCCAGCCCTTAGCCTATATGGGCAAGTTCTCCTTTGACCCCCAGTACCCCGGGGCCGGCTGGAATACAGAGGGAATCTTCAATATAGTGAGTGCTGCTAGCATCCTGGGGGTGCCCCCCTCCTCATCTTCCTCCACCACCTCCTCTAACGCCTCATCGGGGTCCCCCAACCTGAGTTGCAGCATGGCTCATCCCCAGAGTGACATGGACCATATCTACTCACCTCCCCCCTACTCCAGCTGCAATGAGATCTACCAGGACCCCTCGGCTTTCATTGGCACCTCCACAGGGGCACCCTACCCGCCCCCTTCCTACCCTTCTCCTAAGGGGGCGTCGGATGGGAGCGTCTTCCCCATGATCCCGGACTACTNCGCTCTCTTTCCTCCCCAATGCCAAAGAGACTTGCA
                                                      consensus depths      1     1     1     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     211     492 
                                               BLH MIN     211      58 
                                               BLH MPR     190      58 
                                               BLH OVR     211     632 
                                               CDS MIN     211      58 
                                               ORF LNG     211      33 
                                                                                                                                                                                                                                                                     PROTEIN --- Gg ---- 6e-015     NP_989467.1 early growth response 1 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 1e-046     NP_034248.1 early growth response 2 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 8e-062     NP_571072.2 early growth response 2b [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 1e-068     NP_000390.2 early growth response 2 protein [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 1e-108     AAB25681.1 XKr20 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 1e-129     AAI36206.1 Unknown (protein for MGC:122663) [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 1e-129     NP_001093725.1 early growth response 2 (Krox-20 homolog) [Xenopus (Silurana) tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK3224.5                                                     ATG---------------TAA------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  0   1   1           Brn3 FL                          CAAK8228.FL-MGC CTGCTCTGCCAGGGACACTACAACTGCACTGGCACTCTCACTGCTGGAAGCAATGCCAACATGTGCCTGCTAAGCCTACCCTTGGGATGCAGCTAGAGACGCGCCTCAGAGCTGCCAGGGACATCTAAAGAGCTGTTTGTTCCCCCACTATAACAATAATAATAATAATTCAGATTTGCTTGAATTGACCCTGGGGGCACTCGGTGAGACCATGGCTGCCAAAGCGGTAGATAAACTCCCAGTGACTTTTGGTAGTTTTGTGCATCAGTTCCCAGAAGGCATCTACCCCGGGGAGGATTCCACCCTGCCTGCCTCTGTGACCATCTTCCCTAATGTGGACCTGGGGGGACCCTTTGATCAGATGAACAGTGTGACAGGAGATGGAATGATCAGTGTGGATATGAATAATGAGAAGCGATCGCTGGATTTCTCCTACTCGTCCAACTACCCCTCTGCCCCCCGCAGCCAGCCCTTAGCCTATATGGGCAAGTTCTCCTTTGACCCCCAGTACCCCGGGGCCGGCTGGAATACAGAGGGAATCTTCAATATAGTGAGTGCTGCTAGCATCCTGGGGGTGCCCCCCTCCTCATCTTCCTCCACCACCTCCTCTAACGCCTCATCGGGGTCCCCCAACCTGAGTTGCAGCATGGCTCACCCCCAGAGTGACATGGACCATATCTACTCACCTCCCCCCTACTCCAGCTGCAATGAGATCTACCAGGACCCCTCGGCTTTCATTGGCACCTCCACAGGGGCACCCTACCCGCCCCCTTCCTACCCTTCTCCTAAGGGGGCGTCGGATGGGAGCGTCTTCCCCATGATCCCGGACTACTCGGCTCTCTTCCCTCCCCAATGCCAAAGAGACTTGCACTCCATGCCCGATAGGAAACCCTTTCCGTGCCCCCTGGACTCAATCCGGGTCCCCCCACCTCTCACCCCCCTCTCCACCATCCGCAATTTCACATTGGGGGGCTCCAGCAATGAGGGGTCCAGGCTGCCCAGCGCTTACAGCCCCCATAACTTACCACTTCGACCCATCCTCAGACCCAGAAAATACCCCAACCGCCCCAGTAAGACCCCTGTCCACGAAAGACCTTATCCCTGCCCGGCAGAGGGCTGCGACAGACGCTTCTCGCGTTCTGACGAACTGACCAGACATATCCGAATTCACACTGGCCACAAACCCTTCCAGTGTCGCATCTGTATGAGAAACTTCAGCCGCAGCGACCACTTGACTACTCACATCCGGACGCACACCGGGGAGAAACCTTTCGCCTGCGACTACTGCGGGAGAAAGTTCGCCCGGAGCGATGAGCGCAAAAGGCACACAAAAATCCATCTGCGGCAGAAGGAGAGGAAAAACTCGGCAACAGCGGCACCTAGCGGCAGTGCGACCCAAGAGCGACCGCTGAGCCTGAGTCCCGCAGGGACCGGTAACAGTATGTGCTCCACTGGGTCAAGCAGCGGCCAATTGGGACTGTGCCCTAGCCGGACAGGGTGACACACGGACAGTGTAACCCCCACACAGGGATCAAGGGGTCCGTCACTCCCACAAGGATTCCCCAAGAAATCGCACAGCCAGACTTAGTGGCAGTTATCTTTATCCAGGCAATCACCTAGGATACAAACTGGAAACAACCTCCAGCATTAACACCTTTTGATGGGGGGGGTCTATGGTGGGCAAGTTACTGTCAAACGCTAAATAAATGCTTGGTGTTTAGTTCTGGCAGCAAAGTCGAGGTGTGTAAGTCAGAAGGGAGTTAGTGACAAGTCAGTGTAATGTCACCAATAGGAGCTTATATATATGCCAGGGAATGCTTGGGCACAAGTGCTGGGCATCTGTACCATTCATGCAGGGGCTGAGTTGTGGGTTATTAAGGATAAATTCTCTTAGCCCTGCAGAGTTTGCTTAACTACAGCTCCCATCATTTATCTATTGGGAAAAGCAGAGAAAAAGCTGAGCCCCTGTGCAGCCTCTGCAGTAGCAGCTACAGTCCAGCTAATGGCTGCACAAAGGACACATGGGAAACATTTAATTACAAATTTGCAGCAGGGCAGTAATCCAGCAACTAGCTGCAAATAACCCAGGGTTACAATAATGGGTTGCTATTGGTTACTACCTTGGTGCAATTTTGCAGCTGGTCTAGTAACTGAAGGCCAAAAATAATTTCCAGTGAGACATTGTGGTACTGTCCCTTTCCCTTTCTCTCCAAAGCCCCTATGAAAGGAGAATAGCTACATTATTTTATTGGTTCTCCTACTGCAAAAAGACAGTCACATGATAAATCTCTGCCGAAACAGTGCAAAGTCTTGGCAGGAATTTCTCATAGTCAATCCAATCACATTATATTGCACCATTTAATATAAGCAAGCCATTAAAGTGACAGTGGCTGAATTTTGGGAGCAAACACAGTATATTAGAGTGTCGCTGTCTCATCCTTCAGCAGAAAAGGGGGTGTCTGATAGTCCTGGGTGGCCTAATAGACCTGGGCGGGTTGAGCTCCACAGAGTCAAGTGCTGAATAATCAGGTTTGCCTTTTATTTCTTACTAACCGTGTGTCATTTTCATGCGTGATTCTTACTTTTTTGTAACTTTTTGGGGGCTAAATTCAGGGAAAAATGGAGATATGGTAACTTTGAAAGGTGTTTTCTATCCTTTCCCATCCTTGGGGTGAAGCACCTGTAGTAGCCATAGTTTTGTGCACTTTATAACTTCATGACTGCTCCGGAGAGGCGGCATGATATGAAGGGAGGATGTCTGGAATTTCTAAAGCCTACCCTAGATTTAATATTTTCATTTTTTTCCTAATTAATAACATTATTTTTTTTTTGGTGTAACCAATACAGTGTGACTAACAGGAGTGCATTCTAAAGGTACTGTTACGTTTGGCACTGCTGAGTTGTGTAGAACCCTTACATCTCTTTAGGGGACTATTTTATTTCTTTTCAGTGTAAGCCCTGCTGCTGTTGATGAACTACAGATCCCAGAATCCTTAGCTGGGCCTTGTAGTTCAACAACGTGGCAGCAGACATCCACCGACTGTCAATAATGTTGATCTGCACTGTTTTACAGAGTTCCAGACCTTTTTGGTTGGAGTGAAACAGGACTCTGTATGTAATATAGAAGCGCCAGAGAGCCTAATTTATTTAAGGATGTATATAGTTTGTGTACGACGTTAGATTGCATGCCTCTCTGCTACTCAGTGTTCATGGTGCCTTGTGTGATGTGGACAATTCTCGCCCTGTCTGCATGTATATATAGGTTGCCTTATCCACGACACAGCGGTGGCCCGGGGGCCACCGTTTAACATAGCTGTACATTACTGCCAATTAATATTTGGAATTTTTTCTAGAATTTCTATTTTTGTACCCAAACGCACTGTTTTGTGACCCAAAAGTGTTAACTTTGTAGTTGAGTTTACAAAAAAATACAAAATACGGGATAAAAAAATAAGGAAAAAAAAAAGAATATGGCATTGACGGGGCTGCTTCTGTACTCGGAAATAAAGTGTTAAAGAGTTTACTTTATTAATAACCAGCCACTAACTGGAATGGAATCATGAAATGTACTTAGATACAAAGACTGTAAATAAATACTTTTCAACTATAAAAAAAAAAAAAAA
  5   1   2       bld Brn3 FL   out                        CAAK8228.5p CTGCTCTGCCAGGGACACTACAACTGCACTGGCACTCTCACTGCTGGAAGCAATGCCAACATGTGCCTGCTAAGCCTACCCTTGGGATGCAGCTAGAGACGCGCCTCAGAGCTGCCAGGGACATCTAAAGAGCTGTTTGTTCCCCCACTATAACAATAATAATAATAATTCAGATTTGCTTGAATTGACCCTGGGGGCACTCGGTGAGACCATGGCTGCCAAAGCGGTAGATAAACTCCCAGTGACTTTTGGTAGTTTTGTGCATCAGTTCCCAGAAGGCATCTACCCCGGGGAGGATTCCACCCTGCCTGCCTCTGTGACCATCTTCCCTAATGTGGACCTGGGGGGACCCTTTGATCAGATGAACAGTGTGACAGGAGATGGAATGATCAGTGTGGATATGAATAATGAGAAGCGATCGCTGGATTTCTCCTACTCGTCCAACTACCCCTCTGCCCCCCGCAGCCAGCCCTTAGCCTATATGGGCAAGTTCTCCTTTGACCCCCAGTACCCCGGGGCCGGCTGGAATACAGAGGGAATCTTCAATATAGTGAGTGCTGCTAGCATCCTGGGGGTGCCCCCCTCCTCATCTTCCTCCACCACCTCCTCTAACGCCTCATCGGGGTCCCCCAACCTGAGTTGCAGCATGGCTCACCCCCAGAGTGACATGGACCATATCTACTCACCTCCCCCCTACTCCAGCTGCAATGAGATCTACCAGGACCCCTCGGCTTTCATTGGCACCTCCACAGGGGCACCCTACCCGCCCCCTTCCTACCCTTCTCCTAAGGNGGCGTCGGATGGGAGCGTCTTCCCCATGATCCCGGACTACTNCGCTCTCTTTCCTCCCCAATGCCAAAGAGACTTGCACTCCATGCCCG
  5   1   2   14  bld Brn3 5g3  out                        CAAK3221.5p .............GACACTACAACTGCACTGGCACTCTCACTGCTGGAAGCAATGCCAACATGTGCCTGCTAAGCCTACCCTTGGGATGCAGCTAGAGACGCGCCTCAGAGCTGCCAGGGACATCTAAAGAGCTGTTTGTTCCCCCACTATAACAATAATAATAATAATTCAGATTTGCTTGAATTGACCCTGGGGGCACTCGGTGAGACCATGGCTGCCAAAGCGGTAGATAAACTCCCAGTGACTTTTGGTAGTTTTGTGCATCAGTTCCCAGAAGGCATCTACCCCGGGGAGGATTCCACCCTGCCTGCCTCTGTGACCATCTTCCCTAATGTGGACCTGGGGGGACCCTTTGATCAGATGAACAGTGTGACAGGAGATGGAATGATCAGTGTGGATATGAATAATGAGAAGCGATCGCTGGATTTCTCCTACTCGTCCAACTACCCCTCTGCCCCCCGCAGCCAGCCCTTAGCCTATATGGGCAAGTTCTCCTTTGACCCCCAGTACCCCGGGGCCGGCTGGAATACAGAGGGAATCTTCAATATAGTGAGTGCTGCTAGCATCCTGGGGGTGCCCCCCTCCTCATCTTCCTCCACCACCTCCTCTAACGCCTCATCGGGGTCCCCCAACCTGAGTTGCAGCATGGCTCATCCCCAGAGTGACATGGACCATATCTACTCACCTCCCCCCTACTCCAGCTGNCATGAGATCTACCAGGACCCCTCGGCTTTCATTGGCACCTCCACAGGGGCACCCTACCCGCCCCCTTCCTACCCTTCTCCTAAGGGGGCGTCGGATGGGAGCGTCTTCCCCATGAT
  5   1   2   14 seed Brn3 5g3  out                        CAAK3224.5p .............GACACTACAACTGCACTGGCACTCTCACTGCTGGAAGCAATGCCAACATGTGCCTGCTAAGCCTACCCTTGGGATGCAGCTAGAGACGCGCCTCAGAGCTGCCAGGGACATCTAAAGAGCTGTTTGTTCCCCCACTATAACAATAATAATAATAATTCAGATTTGCTTGAATTGACCCTGGGGGCACTCGGTGAGACCATGGCTGCCAAAGCGGTAGATAAACTCCCAGTGACTTTTGGTAGTTTTGTGCATCAGTTCCCAGAAGGCATCTACCCCGGGGAGGATTCCACCCTGCCTGCCTCTGTGACCATCTTCCCTAATGTGGACCTGGGGGGACCCTTTGATCAGATGAACAGTGTGACAGGAGATGGAATGATCAGTGTGGATATGAATAATGAGAAGCGATCGCTGGATTTCTCCTACTCGTCCAACTACCCCTCTGCCCCCCGCAGCCAGCCCTTAGCCTATATGGGCAAGTTCTCCTTTGACCCCCAGTACCCCGGGGCCGGCTGGAATACAGAGGGAATCTTCAATATAGTGAGTGCTGCTAGCATCCTGGGGGTGCCCCCCTCCTCATCTTCCTCCACCACCTCCTCTAACGCCTCATCGGGGTCCCCCAACCTGAGTTGCAGCATGGCTCATCCCCAGAGTGACATGGACCATATCTACTCACCTCCCCCCTACTCCAGCTGCAATGAGATCTACCAGGACCCCTCGGCTTTCATTGGCACCTCCACAGGGGCACCCTACCCGCCCCCTTCCTACCCTTCTCCTAAAGGGGCGTCGGATGGGAGCGTCTTCCCCATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)