Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAP1581.5                           10 END     1          33       10                MGC130872 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012094980 Xt7.1-IMAGE:8945694.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-IMAGE:8945694.5 CTGGTTTGTGCTGCTCAGCCGGCCCCGCCCCCGCACCTCTCACATATTCTATCACTAGGAGCTGAGCTTGTAGAGCTGTAATAGCGCTGAGCCGGCTGCGGTGCGAAGGGCAAAACTCTGCTACACTGAAGTGTCCATAATTACCGGCATTATTTCTTACTCGCTGCTGAGGGCTCATTGTCGGTGCTCTGTGATTGGCTGAATCCTGTTATACATTACTAAGGACAAACGCTATCCAACTAGGGGCTTTTGCGCCATGGATTATGCTTGGCTGTCAGTACTTCTGGGAACTGTGCTGTGGCCCCAAGGGGCCCAAAGCTTGCAGAATGGGCTAGCACTCACACCTCCTATGGGATGGCTCCACTGGGAGAGGTTTCTGTGTGAGACCAATTGTGAGAGGAACCCCAAGAACTGTATAAGTGAACAGCTGTTCATGGACATGGCTGACAAGATGGTGTCTGAAGGCTGGCTGGATGCAGGATATCAATACTTGTGTATTGATGATTGCTGGTTGGCTCCAGAAAGAGATGAAAAAAACAGGCTTCAAGCTGACCCTGTGCGATTCCCAGGGGGTATTAAGAAGCTAGCTGACTATGTTCATTCTCGTGGATTACTTCTGGGAATTTACGAAGATGTGGGAAGTAAAACATGTGAAGGGTTTCCAGGAAGCCAGGGTTATTATGACATAGATGCACAGACCTTTGCTGAATGGGGGGTGGATCTGCTAAAATTTGATGGTTGCTACTATGGGACACTGGACAAACTGGAGGATGGATATCGCCAAATGTCTATGGCACTGAATCGCACTGGGAGAAGATTGTGCTTTCCTGTGAATGGGCCTTTATACGAACGGGTATAAGAGATCATTACTCTGAGTGCTGATACTGCATCTGAGATTTCGTGACTCACAGACTCTGGGGGAGTGTAAGCTGTGATGACTGAGCTCTGCTGTGCAAGAGACTTGTCCCTGTGCTGTCCTGGTCATGCATGATCCGACATGCCTGTGAACTAGGCCAAATG
                                                  Xt7.1-CHK-1008250004       TGTGCTGCTCAGCCGGCCCCGCCCCCGCACCTCTCACATATTCTATCACTAGGAGCTGAGCTTGTAGAGCTGTAATAGCGCTGAGCCGGCTGCGGTGCGAAGGGCAAAACTCTGCTACACTGAAGTGTCCATAATTACCGGCATTATTTCTTACTCGCTGCTGAGGGCTCATTGTCGGTGCTCTGTGATTGGCTGAATCCTGTTATACATTACTAAGGACAAACGCTATCCAACTAGGGGCTTTTGCGCCATGGATTATGCTTGGCTGTCAGTACTTCTGGGAACTGTGCTGTGGCCCCAAGGGGCCCAAAGCTTGCAGAATGGGCTAGCACTCACACCTCCTATGGGATGGCTCCACTGGGAGAGGTTTCTGTGTGAGACCAATTGTGAGAGGAACCCCAAGAACTGTATAAGTGAACAGCTGTTCATGGACATGGCTGACAAGATGGTGTCTGAAGGCTGGCTGGATGCAGGATATCAATACTTGTGTATTGATGATTGCTGGTTGGCTCCAGAAAGAGATGAAAAAAACAGGCTTCAAGCTGACCCTGTGCGATTCCCAGGGGGTATTAAGAAGCTAGCTGACTATGTTCATTCTCGTGGATTACTTCTGGGAATTTACGAAGATGTGGGAAGTAAAACATGTGAAGGGTTTCCAGGAAGCCAGGGTTATTATGACATAGATGCACAGACCTTTGCTGAATGGGGGGTGGATCTGCTAAAATTTGATGGTTGCTACTATGGGACACTGGACAAACTGGAGGATGGATATCGCCAAATGTCTATGGCACTGAATCGCACTGGGAGAAGATTGTGCTTTCCTGTGAATGGGCCTTTATACGAACGGGTATAAGAGATCATTACTCTGAGTGCTGATACTGCATCTGAGATTTCGTGACTCACAGACTCTGGGGGAGTGTAAGCTGTGATGACTGAGCTCTGCTGTGCAAGAGACTTGTCCCTGTGCTGTCCTGGTCATGCATGATCCGACATGCCTGTGAACTAGGC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     1     2     1     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     256     117 
                                               BLH MIN     238      76 
                                               BLH MPR     205      76 
                                               BLH OVR     256     750 
                                               ORF LNG     256      28 
                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Ce ==== 2e-048     NP_506031.1 Alpha-N-Acetylgalactosaminidase precursor (51.4 kD) (5M569) [Caenorhabditiselegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ==== 5e-053     NP_609354.1 CG5731-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                    PROTEIN --- Xt ---- 5e-055     AAI22060.1 LOC779501 protein [Xenopus tropicalis] ---------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 2e-056     NP_001032465.1 hypothetical protein LOC560778 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 2e-063     XP_792642.2 PREDICTED: similar to Chain A, The Structure Of Alpha-N-Acetylgalactosaminidase [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                          PREDICTED - Gg ---- 6e-072     XP_420183.2 PREDICTED: similar to alpha-galactosidase A precursor (EC 3.2.1.22) [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 1e-075     NP_038491.1 galactosidase, alpha [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 8e-078     NP_000160.1 galactosidase, alpha [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 2e-104     AAI06338.1 MGC130872 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PREDICTED = ?? ==== 2e-104     NP_001089687.1 hypothetical protein LOC734749 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-IMAGE:8945694.5                                                        TAG------------TAG------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------TAA------------------------------------------TGA---------------------TAA------ATG---------------------------------------------------TGA------ATG---------TAG
                                                                   ORF                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2   20 seed Te1  5g                             CBWN15757.b1 CTGGTTTGTGCTGCTCAGCCGGCCCCGCCCCCGCACCTCTCACATATTCTATCACTAGGAGCTGAGCTTGTAGAGCTGTAATAGCGCTGAGCCGGCTGCGGTGCGAAGGGCAAAACTCTGCTACACTGAAGTGTCCATAATTACCGGCATTATTTCTTACTCGCTGCTGAGGGCTCATTGTCGGTGCTCTGTGATTGGCTGAATCCTGTTATACATTACTAAGGACAAACGCTATCCAACTAGGGGCTTTTGCGCCATGGATTATGCTTGGCTGTCAGTACTTCTGGGAACTGTGCTGTGGCCCCAAGGGGCCCAAAGCTTGCAGAATGGGCTAGCACTCACACCTCCTATGGGATGGCTCCACTGGGAGAGGTTTCTGTGTGAGACCAATTGTGAGAGGAACCCCAAGAACTGTATAAGTGAACAGCTGTTCATGGACATGGCTGACAAGATGGTGTCTGAAGGCTGGCTGGATGCAGGATATCAATACTTGTGTATTGATGATTGCTGGTTGGCTCCAGAAAGAGATGAAAAAAACAGGCTACAAGCTGACCCTGTGCGATTCCCAGGGGGTATTAAGAAGCTAGCTGACTATGTTCATTCTCGTGGATTACTTCTGGGAATTTACGAAGATGTGGGAAGTAAAACATGTGAAGGGTTTCCAGGAAGCCAGGGTTATTATGACATAGATGCACAGACCTTTGCTGAATGGGGGGTGGATCTGCTAAAATTTGATGGTTGCTACTATGGGACACTGGACAAACTGGAGGATGGATATCGCCAAATGTCTATGGGCACTGAATCGCACTG
  5   1   2       bld In54 PIPE                       IMAGE:8945694.5p                                                                                             CGGCTGCGGTGCGAAGGGCAAAACTCTGCTACACTGAAGTGTCCATAATTACCGGCATTATTTCTTACTCGCTGCTGAGGGCTCATTGTCGGTGCTCTGTGATTGGCTGAATCCTGTTATACATTACTAAGGACAAACGCTATCCAACTAGGGGCTTTTGCGCCATGGATTATGCTTGGCTGTCAGTACTTCTGGGAACTGTGCTGTGGCCCCAAGGGGCCCAAAGCTTGCAGAATGGGCTAGCACTCACACCTCCTATGGGATGGCTCCACTGGGAGAGGTTTCTGTGTGAGACCAATTGTGAGAGGAACCCCAAGAACTGTATAAGTGAACAGCTGTTCATGGACATGGCTGACAAGATGGTGTCTGAAGGCTGGCTGGATGCAGGATATCAATACTTGTGTATTGATGATTGCTGGTTGGCTCCAGAAAGAGATGAAAAAAACAGGCTTCAAGCTGACCCTGTGCGATTCCCAGGGGGTATTAAGAAGCTAGCTGACTATGTTCATTCTCGTGGATTACTTCTGGGAATTTACGAAGATGTGGGAAGTAAAACATGTGAAGGGTTTCCAGGAAGCCAGGGTTATTATGACATAGATGCACAGACCTTTGCTGAATGGGGGGTGGATCTGCTAAAATTTGATGGTTGCTACTATGGGACACTGGACAAACTGGAGGATGGATATCGCCAAATGTCTATGGCACTGAATCGCACTGGGAGAAGATTGTGCTTTCCTGTGAATGGGCCTTTATACGAACGGGTATAAGAGATCATTACTCTGAGTGCTGATACTGCATCTGAGATTTCGTGACTCACAGACTCTGGGGGAGTGTAAGCTGTGATGACTGAGCTCTGCTGTGCAAGAGACTTGTCCCTGTGCTGTCCTGGTCATGCATGATCCGACATGCCTGTGAACTAGGCCAAATG
  5   1   2   10  bld Ski1 5g3  out                        CABJ5843.5p ........................................................................................................................CTACACTGAAGTGTCCATAATTACCGGCATTATTTCTTACTCGCTGCTGAGGGCTCATTGTCGGTGCTCTGTGATTGGCTGAATCCTGTTATACATTACTAAGGACAAACGCTATCCAACTAGGGGCTTTTGCGCCATGGATTATGCTTGGCTGTCAGTACTTCTGGGAACTGTGCTGTGGCCCCAAGGGGCCCAAAGCTTGCAGAATGGGCTAGCACTCACACCTCCTATGGGATGGCTCCACTGGGAGAGGTTTCTGTGTGAGACCAATTGTGAGAGGAACCCCAAGAACTGTATAAGTGAACAGCTGTTCATGGACATGGCTGACAAGATGGTGTCTGAAGGCTGGCTGGATGCAGGATATCAATACTTGTGTATTGATGATTGCTGGTTGGCTCCAGAAAGAGATGAAAAAAACAGGCTTCAAGCTGACCCTGTGCGATTCCCAGGGGGTATTAAGAAGCTAGCTGACTATGTTCATTCTCGTGGATTACTTCTGGGAATTTACGAAGATGTGGGAAGTAAAACATGTGAAGGGTTTCCAGGAAGCCAGGGTTATTATGACATAGATGCACAGACCTTTGCTGAATGGGGGGTGGATCTGCTAAAATTTGATGGTTGCTACTATGGGACACTGGACAAACTGGAGGATGGATATCGCCAAATGTCTATGGCACTGAATCGCACTGNGAGAAAGATTGTGCTTTCCTGTGAATGGCCTTTATACGAACGGGGTATAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)