Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 87%

 1012095824 Xt7.1-CCAX4917.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CCAX4917.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGGAAGGATTTCCCCCCGTGTAGCCTCACATGGACTGTGCCCCTAGCCCTGCTCTGCTGTGAGCCAGCGGCCCTACTTATAGGATGAACTGTCTCGTTTATGCTCTAGGATCCCTTTTCCTTCTGAGTGGGCTCCTCCTCCCCAGCTCTGAAGGGAAGAAGAAGGTTAGTGGATCACAGGGAGCCATTCCTCCCCCTGACAAAGGGCAGCCCAATGACTCTGAACAAGGTCAAACACAGCCAGGAGGCCGGGGCCGAGTTAAAGGGAAGGGACAAGCACTAGCAGCTGAAGAAGTGCTCGAGTCCAGTCAAGAAGCTCTACATATCACTGAACGCAAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACTATTCATGAGGATGGGTGTAACAGTCGTACCATCATCAACCGCTTTTGCTATGGGCAATGCAACTCCTTCTATATCCCCCGTCACATACGCAGGGAGGAGGGCTCCTTTCAATCCTGCTCCTTCTGCAAACCTAAAAAATTTACCACAATGGTGGTCACCCTGAACTGTCCAGAGCTTCAGCCTCCCACAAAGAAGAAGAGAATCACACGTGTCAAGCAATGTCGCTGCATCTCCATAGACCTGGACTAATGGTCCCCGGGCCTGTGAGCACTAGAATAATGGGAGCTTCGCACTTCGTATTCATACCATTTCTGTCTGTGCCAAGACCAGCAAACCGTGGCCCTCACAGACGTTCAGTTGTGTCCGAGCCACTTTATGCTTTCAGAGAAAAACAGCTCATGCTACTACACCATAGGCAGGAATCCGAACAAGCAATAAATATATAGATTTAGTCCTTCTGTTGAACTATCCTAATCAGTGTTGGGTTCCTTATATTTTCTAGGGAATATGGAGGCCTGCAAAGCGAGTATCCATGTATACATTGTGTACATATATATTATTTATTCTCACGTGTGTGTTTCTGTGCACATGAAAGAGCATGAGGGAAGGAAGCCAAGGCTGTTAATATCTGGACTTGCTGTTAAGCACTAGGAGTTAATGAATTGTGCATGTTACTGGCATGTAGCAGTGAATGGCCACTGCAGGAGACCCATTATTAAGGCAACATGTAACTTTCTGACTTTGCAAGGTTCACTGTGGGTAAACATGCCTTAAGAACAATACATTCTCTTTTCCATGGGTTAATCTGCCAGGAACCAGAAAAATACGGCAGTGTATAAATTCAGTTCGAAGACAGAGGATGCCATGTTAGGCATGTACAGTCTGATCATCTAAATATATCTTCTCAAACT
                                                  Xt7.1-CHK-1008244079                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGATTTCCCCCCGTGTAGCCTCACATGGACTGTGCCCCTAGCCCTGCTCTGCTGTGAGCCAGCGGCCCTACTTATAGGATGAACTGTCTCGTTTATGCTCTAGGATCCCTTTTCCTTCTGAGTGGGCTCCTCCTCCCCAGCTCTGAAGGGAAGAAGAAGGTTAGTGGATCACAGGGAGCCATTCCTCCCCCTGACAAAGGGCAGCCCAATGACTCTGAACAAGGTCAAACACAGCCAGGAGGCCGGGGCCGAGTTAAAGGGAAGGGACAAGCACTAGCAGCTGAAGAAGTGCTCGAGTCCAGTCAAGAAGCTCTACATATCACTGAACGCAAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACTATTCATGAGGATGGGTGTAACAGTCGTACCATCATCAACCGCTTTTGCTATGGGCAATGCAACTCCTTCTATATCCCCCGTCACATACGCAGGGAGGAGGGCTCCTTTCAATCCTGCTCCTTCTGCAAACCTAAAAAATTTACCACAATGGTGGTCACCCTGAACTGTCCAGAGCTTCAGCCTCCCACAAAGAAGAAGAGAATCACACGTGTCAAGCAATGTCGCTGCATCTCCATAGACCTGGACTAATGGTCCCCGGGCCTGTGAGCACTAGAATAATGGGAGCTTCGCACTTCGTATTCATACCATTTCTGTCTGTGCCAAGACCAGCAAACCGTGGCCCTCACAGACGTTCAGTTGTGTCCGAGCCACTTTATGCTTTCAGAGAAAAACAGCTCATGCTACTACACCATAGGCAGGAATCCGAACAAGCAATAAATATATAGATTTAGTCCTTCTGTTGAACTATCCTAATCAGTGTTGGGTTCCTTATATTTTCTAGGGAATATGGAGGCCTGCAAAGCGAGTATCCATGTATACATTGTGTACATATATATTATTTATTCTCACGTGTGTGTTTCTGTGCACATGAAAGAGCATGAGGGAAGGAAGCCAAGGCTGTTAATATCTGGACTTGCTGTTAAGCACTAGGAGTTAATGAATTGTGCATGTTACTGGCATGTAGCAGTGAATGGCCACTGCAGGAGACCCATTATTAAGGCAACATGTAACTTTCTGACTTTGCAAGGTTCACTGTGGGTAAACATGCCTTAAGAACAATACATTCTCTTTTCCATGGGTTAATCTGCCAGGAACCAGAAAAATACGGCAGTGTATAAATTCAGTTCGAAGACAGAGGATGCCATGTTAGGCATGTACAGTCTGATCATCTAAATATATCTTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      85     143                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      76      72                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      85     209                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      85       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Sp ---- 5e-007     XP_780519.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 8e-018     NP_001023876.1 F35B12.10 [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 1e-026     BAE06367.1 DAN [Ciona intestinalis] --------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---- 3e-056     NP_998017.1 gremlin 1 homolog, cysteine knot superfamily [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 2e-084     NP_037504.1 cysteine knot superfamily 1, BMP antagonist 1 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 6e-085     NP_035954.1 cysteine knot superfamily 1, BMP antagonist 1; down-regulated inv-mos-transformed cells; Gremlin1 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Gg ==== 6e-087     NP_990309.1 gremlin [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 3e-102     AAC41279.1 gremlin [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 1e-105     AAI35480.1 Unknown (protein for MGC:121475) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 1e-105     NP_001093701.1 gremlin 1 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CCAX4917.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAG------ATG---------------------------TGA---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------TAA---------------TGA---------TAA------------------------------------------------------------------------------------------------ATG---------------------------------------------------------TAA---------------------------------TAA---------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------TAG------ATG---------------------------------------------------------------------------------------------------------ATG---TAA---------------------ATG---TAA------------------------------------------------------------ATG------ATG---------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Tad5 FL                          XZT36221.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGATTTCCCCCCGTGTAGCCTCACATGGACTGTGCCCCTAGCCCTGCTCTGCTGTGAGCCAGCGGCCCTACTTACAGGATGAACTGTCTCGTTTATGCTCTAGGATCCCTTTTCCTTCTGAGTGGGCTCCTCCTCCCCAGCTCTGAAGGGAAGAAGAAGGTTAGTGGATCACAGGGAGCCATTCCTCCCCCTGACAAAGGGCAGCCCAATGACTCTGAACAAGGTCAAACACAGCCAGGAGGCCGGGGCCGAGTTAAAGGGAAGGGACAAGCACTAGCAGCTGAAGAAGTGCTCGAGTCCAGTCAAGAAGCTCTACATATCACTGAACGCAAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACTATTCATGAGGATGGGTGTAACAGTCGTACCATCATCAACCGCTTTTGCTATGGGCAATGCAACTCCTTCTATATCCCCCGTCACATACGCAGGGAGGAGGGCTCCTTTCAATCCTGCTCCTTCTGCAAACCTAAAAAATTTACCACAATGGTGGTCACCCTGAACTGTCCAGAGCTTCAGCCTCCCACAAAGAAGAAGAGAATCACACGTGTCAAGCAATGTCGCTGCATCTCCATAGACCTGGACTAATGGTCCCCGGGCCTGTGAGCACTAGAATAATGGGAGCTTCGCACTTCGTATTCATACCATTTCTGTCTGTGCCAAGACCAGCAAACCGTGGCCCTCACAGACGTTCAGTTGTGTCCGAGCCACTTTATGCTTTCAGAGAAAAACAGCTCATGCTACTACACCATAGGCAGGAATCCGAACAAGCAATAAATATATAGATTTAGTCCTTCTGTTGAACTATCCTAATCAGTGTTGGGTTCCTTATATTTTCTAGGGAATATGGAGGCCTGCAAAGCGAGTATCCATGTATACATTGTGTACATATATATTATTTATTCTCACGTGTGTGTTTCTGTGCACATGAAAGAGCATGAGGGAAGGAAGCCAAGGCTGTTAATATCTGGACTTGCTGTTAAGCACTAGGAGTTAATGAATTGTGCATGTTACTGGCATGTAGCAGTGAATGGCCACTGCAGGAGACCCATTATTAAGGCAACATGTAACTTTCTGACTTTGCAAGGTTCACTGTGGGTAAACATGCCTTAAGAACAATACATTCTCTTTTCCATGGGTTAATCTGCCAGGAACCAGAAAAATACGGCAGTGTATAAATTCAGTTCGAAGACAGAGGATGCCATGTTAGGCATGTACAGTCTGATCATCTAAATATATCTTCTCAAACTGTAAAAAAAAAAAAAAAA
  5   1   2   10 seed Eye  5g3  in                         CCAX4917.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTGGAAGGATTTCCCCCCGTGTAGCCTCACATGGACTGTGCCCCTAGCCCTGCTCTGCTGTGAGCCAGCGGCCCTACTTATAGGATGAACTGTCTCGTTTATGCTCTAGGATCCCTTTTCCTTCTGAGTGGGCTCCTCCTCCCCAGCTCTGAAGGGAAGAAGAAGGTTAGTGGATCACAGGGAGCCATTCCTCCCCCTGACAAAGGGCAGCCCAATGACTCTGAACAAGGTCAAACACAGCCAGGAGGCCGGGGCCGAGTTAAAGGGAAGGGACAAGCACTAGCAGCTGAAGAAGTGCTCGAGTCCAGTCAAGAAGCTCTACATATCACTGAACGCAAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACTATTCATGAGGATGGGTGTAACAGTCGTACCATCATCAACCGCTTTTGCTATGGGCAATGCAACTCCTTCTATATCCCCCGTCACATACGCAGGGAGGAGGGCTCCTTTCAATCCTGCTCCTTCTGCAAACCTAAAAAATTTACCACAATGGTGGTCACCCTGAACTGTCCAGAGCTTCAGCCTCCCACAAAGAAGAAGAGAATCACACGTGTCAAGCAATGTCGCTGCATCTCCATAGACCTGGACTAATGGTCCCCGGGCCTGTGAGCACTAGAATAATGGGAGCTTCGCACTTCGTATTCATACCATTTCTGTCTGTGCCAAGACCAGCAAACCGTGGCCCTCACAGACGTTCAGTTGTGTCCGAGCCACTTTATGCTTTCAGAGAAAAACAG
  5   1   2       bld Tad5 FL   in                         XZT36221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGATTTCCCCCCGTGTAGCCTCACATGGACTGTGCCCCTAGCCCTGCTCTGCTGTGAGCCAGCGGCCCTACTTACAGGATGAACTGTCTCGTTTATGCTCTAGGATCCCTTTTCCTTCTGAGTGGGCTCCTCCTCCCCAGCTCTGAAGGGAAGAAGAAGGTTAGTGGATCACAGGGAGCCATTCCTCCCCCTGACAAAGGGCAGCCCAATGACTCTGAACAAGGTCAAACACAGCCAGGAGGCCGGGGCCGAGTTAAAGGGAAGGGACAAGCACTAGCAGCTGAAGAAGTGCTCGAGTCCAGTCAAGAAGCTCTACATATCACTGAACGCAAGTATCTAAAGAGGGACTGGTGTAAGACTCAGCCCTTAAAGCAAACTATTCATGAGGATGGGTGTAACAGTCGTACCATCATCAACCGCTTTTGCTATGGGCAATGCAACTCCTTCTATATCCCCCGTCACATACGCAGGGAGGAGGGCTCCTTTCAATCCTGCTCCTTCTGCAAACCTAAAAAATTTACCACAATGGTGGTCACCCTGAACTGTCCAGAGCTTCAGCCTCCCACAAAGAAGAAGAGAATCACACGTGTCAAGCAATGTCGCTGCATCTCCATAGACCTGGACTAATGGTCCCCGGGCCTGTGAGCACTAGAATAATGGGAGCTTCGCACTTCGTATTCATACCATTTCTGTCTGTGCCAAGACCAGCAAACCGTGGCCCTCACAGACGTTCAGTTGTGTCCGAGCCACTTTATGCTTTCAG
  3   1   2       bld Tad5 FL   in                         XZT36221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAATTTACCACAATGGTGGTCACCCTGAACTGTCCAGAGCTTCAGCCTCCCACAAAGAAGAAGAGAATCACACGTGTCAAGCAATGTCGCTGCATCTCCATAGACCTGGACTAATGGTCCCCGGGCCTGTGAGCACTAGAATAATGGGAGCTTCGCACTTCGTATTCATACCATTTCTGTCTGTGCCAAGACCAGCAAACCGTGGCCCTCACAGACGTTCAGTTGTGTCCGAGCCACTTTATGCTTTCAGAGAAAAACAGCTCATGCTACTACACCATAGGCAGGAATCCGAACAAGCAATAAATATATAGATTTAGTCCTTCTGTTGAACTATCCTAATCAGTGTTGGGTTCCTTATATTTTCTAGGGAATATGGAGGCCTGCAAAGCGAGTATCCATGTATACATTGTGTACATATATATTATTTATTCTCACGTGTGTGTTTCTGTGCACATGAAAGAGCATGAGGGAAGGAAGCCAAGGCTGTTAATATCTGGACTTGCTGTTAAGCACTAGGAGTTAATGAATTGTGCATGTTACTGGCATGTAGCAGTGAATGGCCACTGCAGGAGACCCATTATTAAGGCAACATGTAACTTTCTGACTTTGCAAGGTTCACTGTGGGTAAACATGCCTTAAGAACAATACATTCTCTTTTCCATGGGTTAATCTGCCAGGAACCAGAAAAATACGGCAGTGTATAAATTCAGTTCGAAGACAGAGGATGCCATGTTAGGCATGTACAGTCTGATCATCTAAATATATCTTCTCAAACTTAAAAAAAAAAAAAAAAGG
  3   1   2      skin Eye  5g3  in                         CCAX4917.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAATGGAAGCTTCGCCACTTCGTATTCATACCATTTCTGTCTGTGCCAAGACCAGCAAACCGTGGCCCTCACAGACGTTCAGTTGTGTCCGAGCCACTTTATGCTTTCAGAGAAAAAACAGCTCATGCTACTACACCATAGGCAGGAATCCGAACAAGCAATAAATATATAGATTTAGTCCTTCTGTTGAACTATCCTAATCAGTGTTGGGTTCCTTATATTTTCTAGGGAATATGGAGGCCTGCAAAGCGAGTATCCATGTATACATTGTGTACATATATATTATTTATTCTCACGTGTGTGTTTCTGTGCACATGAAAGAGCATGAGGGAAGGAAGCCAAGGCTGTTAATATCTGGACTTGCTGTTAAGCACTAGGAGTTAATGAATTGTGCATGTTACTGGCATGTAGCAGTGAATGGCCACTGCAGGAGACCCATTATTAAGGCAACATGTAACTTTCTGACTTTGCAAGGTTCACTGTGGGTAAACATGCCTTAAGAACAATACATTCTCTTTTCCATGGGTTAATCTGCCAGGAACCAGAAAAATACGGCAGTGTATAAATTCAGTTCGAAGACAGAGGATGCCATGTTAGGCATGTACAGTCTGATCATCTAAATATATCTTCTCAAACTGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)