Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC5871.5.5                         10 END     1          33       10                (no blast hit)
     2   2.0    0Xt7.1-XZT70463.5                            3 END     1          33       33                PREDICTED: similar to prune homolog, partial [Danio rerio]

 This cluster: approximate FL confidence score = 28%

 1012095858 Xt7.1-CABC5871.3 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABC5871.3 CGCCTGGGCTGTGTGGGTGAGCCTCACTTACAGCGCCTCATTGCGAGTGATTGGTCTTCGCGCTGCGGGACAAGCCGGAGGCATGGAGCACTTTCTGCAGGGTTGCAAGGCAGCTGTACAGAATATCCCTGAAGCTCTCGACTTCCATGTGGTTCTGGGGAATGAAGCCTGCGATCTGGATTCTATGGTCTCCGCCATTTCTTTAGCCTACTACCTGGCAAAGACCTCTACTAGTAAGAACCTAGCATATCTCCCTGTCCTGAACATCCAACGGGAGGATTTCCCACTGCGCACGGAAAGTACCTACTTCTTGAAGCAGAATGGGATCCCGGAGGGGCACCTCATCTTCCGAAACGAAATCGATCTCCAGACCCTCTATGAATCTGGGCATCTGGTGCTCACACTCGTGGATCACAATGTGTTACCCAGGGGAGACTCCTATCTGGAAGACGTAGTGGCCGAGGTTATAGATCACCGCCACCTTGAGAGACCGGCTGCCCTCAACTGCAAAGTCACGTCGGAGCTGGTGGGATCCTGCACTACGTTAGTAGCGGAGAAGATTATTCACGGGGCCCCAGAAATCTTGGACTTGCAGTTGGCCTCTTTGTTACGAGATACCATTGTCCTGGACTGTATCAATATGGCGCCCGCGGCTGGCAAAGTGACCCCCAAAGATACCGAGTATGTTACAACGCTGGAGTCGATGTTCCCCAGTCTCCCCCCTAGGGGCACTGTGTTTGATTCTCTGCAGANAGCCAAGTTTGATGTATCAGGTCTCACTACCGATCAGATGCTGAGGAAGGACCTGAAGGTGCTGGTCAGTCGGGATATCAGTCTCGCCATCAGCGCCCTGTACATGAAGTTAGAGGACTTCATGCAGAAAGAGGATATCGAATCTGACCTGTGTTCATTTCTGCGGAGGCATCACTACAATGT
                                                  Xt7.1-CHK-1008249642       GGCTGTGTGGGTGAGCCTCACTTACAGCGCCTCATTGCGAGTGATTGGTCTTCGCxxxGxGGGACAAGCCGGAGGCATGGAGCACTTTCTGCAGGGTTGCAAGGCAGCTGTACAGAATATCCCTGAAGCTCTCGACTTCCATGTGGTTCTGGGGAATGAAGCCTGCGATCTGGATTCTATGGTCTCCGCCATTTCTTTAGCCTACTACCTGGCAAAGACCTCTACTAGTAAGAACCTAGCATATCTCCCTGTCCTGAACATCCAACGGGAGGATTTCCCACTGCGCACGGAAAGTACCTACTTCTTGAAGCAGAATGGGATCCCGGAGGGGCACCTCATCTTCCGAAACGAAATCGATCTCCAGACCCTCTATGAATCTGGGCATCTGGTGCTCACACTCGTGGATCACAATGTGTTACCCAGGGGAGACTCCTATCTGGAAGACGTAGTGGCCGAGGTTATAGATCACCGCCACCTTGAGAGACCGGCTGCCCTCAACTGCAAAGTCACGTCGGAGCTGGTGGGATCCTGCACTACGTTAGTAGCGGAGAAGATTATTCACGGGGCCCCAGAAATCTTGGACTTGCAGTTGGCCTCTTTGTTACGAGATACCATTGTCCTGGACTGTATCAATATGGCGCCCGCGGCTGGCAAAGTGACCCCCAAAGATACCGAGTATGTTACAACGCTGGAGTCGATGTTCCCCAGTCTCCCCCCTAGGGGCACTGTGTTTGATTCTCTGCAGANAGCCAAGTTTGATGTATCAGGTCTCACTACCGATCAGATGCTGAGGAAGGACCTGAAGGTGCTGGTCAGTCGGGATATCAGTCTCGCCATCAGCGCCCTGTACATGAAGTTAGAGGACTTCATGCAGAAAGAGGATATCGAATCTGACCTGTGTTCATTTCTGCGGAGGCATCACTA
                                                      consensus depths      1     1     1     1     1     1     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      82      41 
                                               BLH MIN      55      38 
                                               BLH MPR      46      38 
                                                                                                                                 PROTEIN --- Sc ---- 2e-014     NP_012071.1 Exopolyphosphatase, hydrolyzes inorganic polyphosphate (poly P) into Pi residues; located in the cytosol, plasma membrane, and mitochondrial matrix [Saccharomyces cerevisiae] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PROTEIN -== Dm ==== 8e-037     NP_476684.1 CG3461-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                             PREDICTED = Gg ==== 9e-057     XP_424651.2 PREDICTED: hypothetical protein, partial [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PREDICTED = Dr ==== 9e-078     XP_691799.1 PREDICTED: similar to PRUNEM1, partial [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PROTEIN === Mm ==== 7e-086     NP_775482.1 PRUNEM1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PROTEIN === Hs ==== 3e-086     NP_067045.1 TcD37 homolog; prune [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABC5871.3                                                                                   ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------ATG
                                                                   ORF                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  0   1   1           Egg  FL                     TEgg065k08.FL-Sanger   CGCCTGGGCTGTGTGGGTGAGCCTCACTTACAGCGCCTCAGTGCGAGTGATTGGTCAGCGCTGCGGGACAAGCCGGAGGCATGGAGCACTTTCTGCAGGGTTGCAAGGCAGCTGTACAGAATATCCCTGAAGCTCTCGACTTCCATGTGGTTCTGGGGAATGAAGCCTGCGATCTGGATTCTATGGTCTCCGCCATTTCTTTAGCCTACTACCTGGCAAAGACCTCTACTAGTAAGAACCTAGCATATCTCCCTGTCCTGAACATCCAACGGGAGGATTTCCCACTGCGCACGGAAAGTACCTACTTCTTGAAGCAGAATGGGATCCCGGAGGGGCACCTCATCTTCCGAAACGAAATCGATCTCCAGACCCTCTATGAATCTGGGCATCTGGTGCTCACACTCGTGGATCACAATGTGTTACCCAGGGGAGACTCCTATCTGGAAGACGTAGTGGCCGAGGTTATAGATCACCGCCACCTTGAGAGACCGGCTGCCCTCAACTGCAAAGTCACGTCGGAGCTGGTGGGATCCTGCACTACGTTAGTAGCGGAGAAGATTATTCACGGGGCCCCAGAAATCTTGGACTTGCAGTTGGCCTCTTTGTTACGAGATACCATTGTCCTGGACTGTATCAATATGGCGCCCGCGGCTGGGAAAGTGACCCCCAAAGATACCGAGTATGTTACGGCGCTGGAGTCGATGTTCCCCAGTCTCCCCCCTAGGGGCGCTGTGTTTGATTCCCTGCAGAAAGCCAAGTTTGATGTATCAGGTCTCACTACCGATCAGATGCTGAGGAAGGACCTGAAGGTGCTGGTCAGTCGGGATATCAGTCTCGCCATCAGCGCCCTGTACATGAAGTTAGAGGACTTCATGCAGAAGGAGGATATCGAATCTGACCTGTGTTCATTCTGCCGGAGGCATCACTACAATGTTTTGGTTGCCATGGCGATTACTTTTAATAGGGAGAACGAACCCATGAGGCAGATCGCGGTGTACAGCCAGAAGGAGGGGCTTAGACGAGTGGTGTGCAAAGCCTTGCAGCAAGCTACCAACCCACCCCTCGACCTGACCGCCATAGCCTGCCCTCCGTGTCCCAGTACCACCACTTACCAACAAGGCAACACCGCTGCGTCCCGCAAAAAGGTCCTTCCCATCCTGAAAGATTTCCTGAGGAAGAGAGACCTGGAGGAGAGCTCCCCGATATCCATGCAGTCCTTGGAGAACCCGGAGACATCCAATGATTTCTCAGGCTTCAGGGAAAGGACCGGCGACGACAACTTGGAGGGCGGAGAGTTGTTTGGGGATTGTGGGGAGCAGCCGGAAGGCCAAGATGGTTGCCCTGGAGAAGATGTTAGGAGCAAAGGATTTATTGGCACTTACAGGACACAACTGGACGACGGCTTAGAGGACGAGCGCTCCTTTCCCCCAACGCCTATGAACAGTCTGGTGGAAGGCTGCCCCCTCGACAGGGGTCTCCCAAAACTGACGGCGGAAGCCATTCTAGAAAGGTTCAGCCATATAACTGCTATAGATTCCGAGAGCCAATCAGGGGGCGAAAAGAAATGACCAGATAAGCATTTTTATTCCATTGCATTAGTAATAATATTAATAATAATAATGATGATTTCTTAGCTTTGCCTTTTAATGAAGAGCAATAAAATGTTATTATCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  FL   out                  TEgg065k08.p1kSP6 CGCCTGGGCTGTGTGGGTGAGCCTCACTTACAGCGCCTCATTGCGAGTGATTGGTCTTCGCTGCGGGACAAGCCGGATGCATGGAGCACTTTCTGCAAGGGTGCAAGGCAGCTGTACATAATATCCCTGAAGCTCTCGACTTCCATGTGGTTCTGGGGAATGAAGCCTGCGATCTGGATTCTATGGACTCCGCCATTTCTTTAACCTACTACCTGGCAAAGACCTCTACTAGTAAGAACCTATCATATCTCCCATGTCCTGAACATCACAACGGGAGGATTTCCCACTGCACACGGAAAGTACCTACTTCTTGAAGCAGAATGGGATCCCGGAGGGGCACCTCATCTTCCGAAACGAAATCAATCTCCAGACCCTCTATGAATCTGGGCATCTGGTGCTCACACTCGTGGATCACAATGTGTTACCCAAGGGAGACTCCTATCTGGAAGACGTACTGGCCGAGGTTATAGATCACCGCCACCTTGACAGACCGGCTGCCCTCAACTGCAAAGTCACGTCGGAGCTGGTGGGATCCTGCACTACGTTAGTAGCGGAGAAGATTATTCACGGGGCCCCAGAAATCTTGGACTTGCAGTTGGCCTCTTTGTTACGAGATACCATTGTCCTGGACTGTATCAATATG
  3  -1   2      seed Fat1      out                        CABC5871.3p                               TACAGCGCCTCAGTGCGAGTGATTGGTCAGCGCTGCGGGACAAGCCGGAGGCATGGAGCACTTTCTGCAGGGTTGCAAGGCAGCTGTACAGAATATCCCTGAAGCTCTCGACTTCCATGTGGTTCTGGGGAATGAAGCCTGCGATCTGGATTCTATGGTCTCCGCCATTTCTTTAGCCTACTACCTGGCAAAGACCTCTACTAGTAAGAACCTAGCATATCTCCCTGTCCTGAACATCCAACGGGAGGATTTCCCACTGCGCACGGAAAGTACCTACTTCTTGAAGCAGAATGGGATCCCGGAGGGGCACCTCATCTTCCGAAACGAAATCGATCTCCAGACCCTCTATGAATCTGGGCATCTGGTGCTCACACTCGTGGATCACAATGTGTTACCCAGGGGAGACTCCTATCTGGAAGACGTAGTGGCCGAGGTTATAGATCACCGCCACCTTGAGAGACCGGCTGCCCTCAACTGCAAAGTCACGTCGGAGCTGGTGGGATCCTGCACTACGTTAGTAGCGGAGAAGATTATTCACGGGGCCCCAGAAATCTTGGACTTGCAGTTGGCCTCTTTGTTACGAGATACCATTGTCCTGGACTGTATCAATATGGCGCCCGCGGCTGGCAAAGTGACCCCCAAAGATACCGAGTATGTTACAACGCTGGAGTCGATGTTCCCCAGTCTCCCCCCTAGGGGCACTGTGTTTGATTCTCTGCAGANAGCCAAGTTTGATGTATCAGGTCTCACTACCGATCAGATGCTGAGGAAGGACCTGAAGGTGCTGGTCAGTCGGGATATCAGTCTCGCCATCAGCGCCCTGTACATGAAGTTAGAGGACTTCATGCAGAAAGAGGATATCGAATCTGACCTGTGTTCATTTCTGCGGAGGCATCACTACAATGTTT
  5   1   2       bld Neu  5g                        TNeu109e14.p1cSP6                                                           AGCGCTGCGGGACAAGCCGGAGGCATGGAGCACTTTCTGCAGGGTTGCAAGGCAGCTGTACAGAATATCCCTGAAGCTCTCGACTTCCATGTGGTTCTGGGGAATGAAGCCTGCGATCTGGATTCTATGGTCTCCGCCATTTCTTTAGCCTACTACCTGGCAAAGACCTCTACTAGTAAGAACCTAGCATATCTCCCTGTCCTGAACATCCAACGGGAGGATTTCCCACTGCGCACGGAAAGTACCTACTTCTTGAAGCAGAATGGGATCCCGGAGGGGCACCTCATCTTCCGAAACGAAATCGATCTCCAGACCCTCTATGAATCTGGGCATCTGGTGCTCACACTCGTGGATCACAATGTGTTACCCAGGGGAGACTCCTATCTGGAAGACGTAGTGGCCGAGGTTATAGATCACCGCCACCTTGAGAGACCGGCTGCCCTCAACTGCAAAGTCACGTCGGAGCTGGTGGGATCCTGCACTACGTTAGTAGCGGAGAAGATTATTCACGGGGCCCCAGAAATCTTGGACTTGCAGTTGGCCTCTTGTTACGAGATACCATTGTCCTGGACTGTATCAATATGGCGCCCGCGGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)