Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 41%

 1012096011 Xt7.1-CABE9565.3 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABE9565.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGAAGTACTGGATCATTACTACTATAGAGATACTGAAGTTTTAGGCTGGTGCAAAACCATACGCTTGCCAGATTCAGGGGTGTTGCAAACGATACACTGACCCAAGCTCACTCCGAAAACATGTAAAAGCACATACAACTCGGGAGCAGCAATTGCACACTAAGCTGCTTTCCGCCTCTGATCCAGGGAGGGATACAATCAGTGATAATGCTTGCCTGAAGGTGCCACAAGTGTTTGATGGGATATTGGGTAGAAGCATCAGACACAAGCTTCTGAATGGCACTAGATCACAGGAACTTCTCACAGATTTACATAGTAATGGCATACTCAGGCCTGGATTAATGTCCCAAGTGTCTCCAGTTCCCAAACAGTGTGCTCCACTGGAACACCGTAACACATGCTTGTTGGCAAACAAGGAAGGGACTCAAGAAAGCAAAATGTCATCACTTATCATTCAACACCATGCCAGCCACATGAGATCTCCAGCCCCCTTCATAATGTTGCATAGAGGATCCTCCCCCAACTCCCACAGCAAATTACCTTCGGGGGAACAGTGTTCAACAGAAAAACCTTTCCCTCCCTTCCGCAGCTCAACTGGCACACACACACAAGGTTTCCAAAACACTATGGTGCAGTATTCAGAATATTTTAGGGAAGTGCATTGCCAGAATCCGAACCAGTATAACATGGGGAGCACGCAGTCAGCAGCTTATGACATGCAAGCTACACCTGTGCATTCTCTATCTGATGCCAGCCCAAACTGTTCAGAAGAAAGTGAATTTTTCCAAAATGCCACCATTGATCACTGCTTAAGCCAGATTTCTTACATCTATGCGGATGCATAGATTCTTATTGTTACAAGAGAATTTTTCTGTAAACTGAATGCATTGAAGATGCTTTTTATAAGACATTATTATTTTGCAATAAACTGCTGCTTTCACATTTTTTAAATATTAATTTAGCATAAAAGTTTAATATAAATTATGAAAAAGTAAAGATTGTTTGTCATTTTTAAGAGCTTTCTAAACTATAAACCATACTTTTACAGTATTCAATCTCTTTTATCAAGAGCCTGTAACCTGTTATTTAAAAATCTTTGAATTCTTGAAAAAAGCCAATAATAAAAGACTTTTCCAG
                                                  Xt7.1-CHK-1008244857                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTACTGGATCATTACTACTATAGAGATACTGAAGTTTTAGGCTGGTGCAAAACCATACGCTTGCCAGATTCAGGGGTGTTGCAAACGATACACTGACCCAAGCTCACTCCGAAAACATGTAAAAGCACATACAACTCGGGAGCAGCAATTGCACACTAAGCTGCTTTCCGCCTCTGATCCAGGGAGGGATACAATCAGTGATAATGCTTGCCTGAAGGTGCCACAAGTGTTTGATGGGATATTGGGTAGAAGCATCAGACACAAGCTTCTGAATGGCACTAGATCACAGGAACTTCTCACAGATTTACATAGTAATGGCATACTCAGGCCTGGATTAATGTCCCAAGTGTCTCCAGTTCCCAAACAGTGTGCTCCACTGGAACACCGTAACACATGCTTGTTGGCAAACAAGGAAGGGACTCAAGAAAGCAAAATGTCATCACTTATCATTCAACACCATGCCAGCCACATGAGATCTCCAGCCCCCTTCATAATGTTGCATAGAGGATCCTCCCCCAACTCCCACAGCAAATTACCTTCGGGGGAACAGTGTTCAACAGAAAAACCTTTCCCTCCCTTCCGCAGCTCAACTGGCACACACACACAAGGTTTCCAAAACACTATGGTGCAGTATTCAGAATATTTTAGGGAAGTGCATTGCCAGAATCCGAACCAGTATAACATGGGGAGCACGCAGTCAGCAGCTTATGACATGCAAGCTACACCTGTGCATTCTCTATCTGATGCCAGCCCAAACTGTTCAGAAGAAAGTGAATTTTTCCAAAATGCCACCATTGATCACTGCTTAAGCCAGATTTCTTACATCTATGCGGATGCATAGATTCTTATTGTTACAAGAGAATTTTTCTGTAAACTGAATGCATTGAAGATGCTTTTTATAAGACATTATTATTTTGCAATAAACTGCTGCTTTCACATTTTTTAAATATTAATTTAGCATAAAAGTTTAATATAAATTATGAAAAAGTAAAGATTGTTTGTCATTTTTAAGAGCTTTCTAAACTATAAACCATACTTTTACAGTATTCAATCTCTTTTATCAAGAGCCTGTAACCTGTTATTTAAAAATCTTTGAATTCTTGAAAAAAGCCAATxAxxAAAGACTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2
                                               BLH ATG     344      64                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      47      30                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                       PROTEIN --- Cs ---- 3e-007     BAB68349.1 zic related zinc finger protein Cs-macho1 [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 4e-009     CAB96572.1 AmphiGli protein [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-007     NP_991291.1 GLI-Kruppel family member GLI3 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-008     AAA98466.1 neural specific DNA binding protein [Xenopus laevis]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-010     BAE93317.1 zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-011     XP_798511.2 PREDICTED: similar to GLIS family zinc finger 3 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - ?? ---- 5e-014     XP_686442.1 PREDICTED: similar to GLIS family zinc finger 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Hs ---- 1e-021     NP_671726.1 Gli5-like; Glis1-like [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Mm ---- 3e-026     NP_671754.1 GLIS family zinc finger 1 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-032     XP_422485.2 PREDICTED: similar to GLIS family zinc finger 1 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 1e-096     CAJ82037.1 novel zinc finger protein [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABE9565.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------ATG---------------------------------------------------TAA---------TAG---------------TAA---ATG------TAA------------------------------------------------------------------------------------------------------TGA------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2   10 seed Ova1 5g3  in                         CABE9565.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTGAAGTACTGGATCATTACTACTATAGAGATACTGAAGTTTTAGGCTGGTGCAAAACCATACGCTTGCCAGATTCAGGGGTGTTGCAAACGATACACTGACCCAAGCTCACTCCGAAAACATGTAAAAGCACATACAACTCGGGAGCAGCAATTGCACACTAAGCTGCTTTCCGCCTCTGATCCAGGGAGGGATACAATCAGTGATAATGCTTGCCTGAAGGTGCCACAAGTGTTTGATGGGATATTGGGTAGAAGCATCAGACACAAGCTTCTGAATGGCACTAGATCACAGGAACTTCTCACAGATTTACATAGTAATGGCATACTCAGGCCTGGATTAATGTCCCAAGTGTCTCCAGTTCCCAAACAGTGTGCTCCACTGGAACACCGTAACACATGCTTGTTGGCAAACAAGGAAGGGACTCAAGAAAGCAAAATGTCATCACTTATCATTCAACACCATGCCAGCCACATGAGATCTCCAGCCCCCTTCATAATGTTGCATAGAGGATCCTCCCCCAACTCCCACAGCAAATTACCTTCGGGGGAACAGTGTTCAACAGAAAAACCTTTCCCTCCCTTCCGCAGCTCAACTGGCACACACACACAAGGTTTCCAAAACACTATGGTGCAGTATTCAGAATATTTTAGGGAAGTGCATTGCCAGAATCCGAACCAGTATAACATGGGGAGCACGCAGTCAGCAGCTTATGACATGCAAGCTACACCTGTGCATTCTCTATCTGATGCCAGCCCAAACTGTTCAGAAGAAAGTGAATTTTTCCAAAATGCCACCATTGATCACTGCTTAAGCCAGATTTCTTACATCTATGCGGATGCATAGATTCTTATTGTTACAAGAGAATTTTTCTGTAAACTGAATGCATTGAAGATGCTTTTTTATAGACATTATTATTTTTGCATAAACTGCTGCTT
  5   1   2       bld Egg  FLx                       TEgg138o09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGGACTATAGAGATACTGAAGTTTTAGGCTGGTGCAAAACCATACGCTTGCCAGATTCAGGGGTGTTGCAAACGATACACTGACCCAAGCTCACTCCGAAAACATGTAAAAGCACATACAACTCGGGAGCAGCAATTGCACACTAAGGGAGGGATACAATCAGTGATAATGCTTGCCTGAAGGTGCCACAAGTGTTTGATGGGATATTGGGTAGAAGCATCAGACACAAGCTTCTGAATGGCACTAGATCACAGGAACTGCTCACAGATTTACATAGTAATGGCATACTCAGGCCTGGATTAATGTCCCAAGTGTCTCCAGTTCCCAAACAGTGTGCTCCACTGGAACACCGTAACACATGCTTGTTGGCAAACAAGGAAGGGACTCAAGAAAGCAAAATGTCATCACTTATCATTCAACACCATGCCAGCCACATGAGATCTCCAGCCCCCTTCATAATGTTGCATAGAGGATCCTCCCCCAACTCCCACAGCAAATTACCTTCGGGGGAACAGTGTTCAACAGAAAAACCTTTCCCTCCCTTCCGCAGCTCAACTGGCACACACACACAAGGTTTCCAAAACACTATGGTGCAGTATTCAGAATATTTTAGGGAAGTGCATTGCCAGAATCCGAACCAGTATA
  3   1   2       bld Ova1 5g3  in                         CABE9565.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGGCACTAGATCACAGGACTTTCTCACAGATTTACATAGTAATGGCATACTCAGGCCTGGATTAATGTCCCAAGTGTCTCCAGTTCCCAAACAGTGTGCTCCACTGGAACACCGTAACACATGCTTGTTGGCAAACAAGGAAGGGACTCAAGAAAGCAAAATGTCATCACTTATCATTCAACACCATGCCAGCCACATGAGATCTCCAGCCCCCTTCATAATGTTGCATAGAGGATCCTCCCCCAACTCCCACAGCAAATTACCTTCGGGGGAACAGTGTTCAACAGAAAAACCTTTCCCTCCCTTCCGCAGCTCAACTGGCACACACACACAAGGTTTCCAAAACACTATGGTGCAGTATTCAGAATATTTTAGGGAAGTGCATTGCCAGAATCCGAACCAGTATAACATGGGGAGCACGCAGTCAGCAGCTTATGACATGCAAGCTACACCTGTGCATTCTCTATCTGATGCCAGCCCAAACTGTTCAGAAGAAAGTGAATTTTTCCAAAATGCCACCATTGATCACTGCTTAAGCCAGATTTCTTACATCTATGCGGATGCATAGATTCTTATTGTTACAAGAGAATTTTTCTGTAAACTGAATGCATTGAAGATGCTTTTTATAAGACATTATTATTTTGCAATAAACTGCTGCTTTCACATTTTTTAAATATTAATTTAGCATAAAAGTTTAATATAAATTATGAAAAAGTAAAGATTGTTTGTCATTTTTAAGAGCTTTCTAAACTATAAACCATACTTTTACAGTATTCAATCTCTTTTATCAAGAGCCTGTAACCTGTTATTTAAAAATCTTTGAATTCTTGAAAAAAGNCCAATAATAAAGACTTTTCCAGTTGTT
  3   1   2       bld Te3       out                       CAAM13863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGTTCCCAAACAGTGTGCTCCACTGGAACACCGTAACACATGCTGTTTGGCAAACAAGGAAGGGACTCAAGAAAGCAATGTCATCACTTATCATTCAACACCATGCCAGCCACATGAGATCTCCAGCCCCCTTCATAATGTTGCATAGAGGATCCTCCCCCAACTCCCACAGCAAATTACCTTCGGGGGAACAGTGTTCAACAGAAAAACCTTTCCCTCCCTTCCGCAGCTCAACTGGCACACACACACAAGGTTTCCAAAACACTATGGTGCAGTATTCAGAATATTTTAGGGAAGTGCATTGCCAGAATCCGAACCAGTATAACATGGGGAGCACGCAGTCAGCAGCTTATGACATGCAAGCTACACCTGTGCATTCTCTATCTGATGCCAGCCCAAACTGTTCAGAAGAAAGTGAATTTTTCCAAAATGCCACCATTGATCACTGCTTAAGCCAGATTTCTTACATCTATGCGGATGCATAGATTCTTATTGTTACAAGAGAATTTTTCTGTAAACTGAATGCATTGAAGATGCTTTTTATAAGACATTATTATTTTGCAATAAACTGCTGCTTTCACATTTTTTAAATATTAATTTAGCATAAAAGTTTAATATAAATTATGAAAAAGTAAAGATTGTTTGTCATTTTTAAGAGCTTTCTAAACTATAAACCATACTTTTACAGTATTCAATCTCTTTTATCAAGAGCCTGTAACCTGTTATTTAAAAATCTTTGAATTCTTGAAAAAAGCCAATAATAAAGACTTTTCCAGTTGTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)