Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012096024 Xt7.1-XZG34472.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG34472.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACCTTATATATTGGTTTATGCTAATGACTCTGCAATTTCAGAGCCTGACAGTGTTGTTTCCAGTTTGCATGGGCCACATACTCCTCTAACTCTCAAACCAAACCGGAAAATAGAAAAAGCTGAACAAAGAAAAAAACGATCTACAGACATTCTTTTACCCTTACAAAACAATGAGCTCCCTGGTGCAGAATACCAGTACAGTGTGGATGAAGAGGGTTGGGAAGAAAGAAAACCCTACAAAACTCTTCAGGGACGTCAGAATGAGAAGGATAAAAATAAGAAAAAGCTTAGGAAAAGCAACCGTCAGAAGAGCCAAACACTTCAGTTCGATGAACAGACCTTGAAGAAAGCAAGAAGAAAGCAGTGGAACGAACCACGAAATTGTGCACGGCGTTATCTAAAAGTCGACTTTGCAGACATTGGCTGGAGTGAATGGATTATTTCCCCCAAATCCTTTGATGCATATTACTGCTCAGGTGCATGCCAGTTTCCAATGCCAAAGTCTTTAAAACCTTCGAATCATGCTACTATCCAGAGCATTGTAAGAGCGGTTGGTGTGGTACCTGGAATACCTGAGCCGTGCTGTGTGCCAGAAAAAATGTCTTCATTAAGCATCCTGTTCCTGGATGAAAACAAAAATGTTGTCCTTAAAGTTTATCCCAACATGACAGTGGAGTCTTGTGCCTGTAGATGATATCTTCAAATGCCTACTGAAAAAAGGGAAAAGGTGTTAAAAGCAATCTTCAGTTTTGCACTTTTAGTATATCACATGAAAATGAATTGTCAGTGGCAGACAAAACATTATATAGCAAAAAAAAAAACACTGGTTTTTGGCCTCTGCTTATAGACAAGGAGGGAAATATGGAACCGTGATATAAACATGCCAGAAGCCATACAGACAACAGATATTTCTCTTTTCAAGATGACTGGATTTTTATTTTTCAAACCTCCAAAGATGCACCTATTTTTGTACCAGGAAAAATTAACCTGTAGCTATTGTTCTGTGCCTTCAGAATTATTGGTTTCTAGCTGGTGAATCTAATTTCATATATAAATGGCCAAACATTTATTTAAACGGCTGGTATTTTTTTTCCACAAATACCAATGTCTGTTTCTATACAATGAACAGGAAAATAAATATTTTCATGCTTACACTGCAAGTTGTGCATGCAAAGAATTTTTTTTAAATCTTAGTAAATGTATATAATCTGAAAATATACAAGTTTCTTATCAATACAATATGCAACATTTCAGGTGTAAATTAACTGTAAAATAAACTGATGAATTGTCAAAAAAAAAATAAAGAAGAAGAAATGAAAGAAGCAACAACTAAATAGAAAAAA
                                                  Xt7.1-CHK-1008244258                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATATATTGGTTTATGCTAATGACTCTGCAATTTCAGAGCCTGACAGTGTTGTTTCCAGTTTGCATGGGCCACATACTCCTCTAACTCTCAAACCAAACCGGAAAATAGAAAAAGCTGAACAAAGAAAAAAACGATCTACAGACATTCTTTTACCCTTACAAAACAATGAGCTCCCTGGTGCAGAATACCAGTACAGTGTGGATGAAGAGGGTTGGGAAGAAAGAAAACCCTACAAAACTCTTCAGGGACGTCAGAATGAGAAGGATAAAAATAAGAAAAAGCTTAGGAAAAGCAACCGTCAGAAGAGCCAAACACTTCAGTTCGATGAACAGACCTTGAAGAAAGCAAGAAGAAAGCAGTGGAACGAACCACGAAATTGTGCACGGCGTTATCTAAAAGTCGACTTTGCAGACATTGGCTGGAGTGAATGGATTATTTCCCCCAAATCCTTTGATGCATATTACTGCTCAGGTGCATGCCAGTTTCCAATGCCAAAGTCTTTAAAACCTTCGAATCATGCTACTATCCAGAGCATTGTAAGAGCGGTTGGTGTGGTACCTGGAATACCTGAGCCGTGCTGTGTGCCAGAAAAAATGTCTTCATTAAGCATCCTGTTCCTGGATGAAAACAAAAATGTTGTCCTTAAAGTTTATCCCAACATGACAGTGGAGTCTTGTGCCTGTAGATGATATCTTCAAATGCCTACTGAAAAAAGGGAAAAGGTGTTAAAAGCAATCTTCAGTTTTGCACTTTTAGTATATCACATGAAAATGAATTGTCAGTGGCAGACAAAACATTATATAGCAAAAAAAAAAACACTGGTTTTTGGCCTCTGCTTATAGACAAGGAGGGAAATATGGAACCGTGATATAAACATGCCAGAAGCCATACAGACAACAGATATTTCTCTTTTCAAGATGACTGGATTTTTATTTTTCAAACCTCCAAAGATGCACCTATTTTTGTACCAGGAAAAATTAACCTGTAGCTATTGTTCTGTGCCTTCAGAATTATTGGTTTCTAGCTGGTGAATCTAATTTCATATATAAATGGCCAAACATTTATTTAAACGGCTGGTATTTTTTTTCCACAAATACCAATGTCTGTTTCTATACAATGAACAGGAAAATAAATATTTTCATGCTTACACTGCAAGTTGTGCATGCAAAGAATTTTTTTTAAATCTTAGTAAATGTATATAATCTGAAAATATACAAGTTTCTTATCAATACAATATGCAACATTTCAGGTGTAAATTAACTGTAAAATAAACTGATGAATTGTCAAAAAAAAAATAAAGAAGAAGAAATGAAAGAAGCAACAACTAAATAGAAAAAAAAAATC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Cs ---- 2e-008     BAB68348.1 lefty/antivin related protein [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Br ---- 2e-015     ABD62777.1 myostatin [Branchiostoma lanceolatum] ===========================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 8e-026     NP_477311.1 decapentaplegic CG9885-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 1e-026     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 5e-031     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bf ---- 3e-031     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ---- 3e-030     CAJ81579.1 novel protein similar to anti-dorsalizing morphogenic protein [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 4e-033     XP_786367.1 PREDICTED: similar to bone morphogenetic protein 3 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 5e-037     NP_001071987.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 2e-094     NP_001071233.1 hypothetical protein LOC777717 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 2e-103     NP_775580.1 bone morphogenetic protein 3 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Gg ---- 4e-106     NP_001029991.1 hypothetical protein LOC422581 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 1e-106     NP_001192.1 bone morphogenetic protein 3 (osteogenic) precursor [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ---- 3e-131     BAC77407.1 xBMP-3 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- ?? ---- 3e-131     NP_001084184.1 xBMP-3 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG34472.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------TGA---------ATG---------------------------------------------------------------ATG---ATG------------------------------------------------------------------TAG---------------------------------ATG---------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------TGA---TAA---------TAAATG---------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------ATG------------------------------TAA------------------------TAA---------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Gas7                                 XZG13588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACCTTATATATTGGTTTATGCTAATGACTCTGCAATTTCAGAGCCTGACAGTGTTGTTTCCAGTTTGCATGGGCCACATACTCCTCTAACTCTCAAACCAAACCGGAAAATAGAAAAAGCTGAACAAAGAAAAAAACGATCTACAGACATTCTTTTACCCTTACAAAACAATGAGCTCCCTGGTGCAGAATACCAGTACAGTGTGGATGAAGAGGGTTGGGAAGAAAGAAAACCCTACAAAACTCTTCAGGGACGTCAGAATGAGAAGGATAAAAATAAGAAAAAGCTTAGGAAAAGCAACCGTCAGAAGAGCCAAACACTTCAGTTCGATGAACAGACCTTGAAGAAAGCAAGAAGAAAGCAGTGGAACGAACCACGAAATTGTGCACGGCGTTATCTAAAAGTCGACTTTGCAGACATTGGCTGGAGTGAATGGATTATTTCCCCCAAATCCTTTGATGCATATTACTGCTCAGGTGCATGCCAGTTTCCAATGCCAAAGTCTTTAAAACCTTCGAATCATGCTACTATCCAGAGCATTGTAAGAGCGGTTGGTGTGGTACCTGGAATACCTGAGCCGTGCTGTGTGCCAGAAAAAATGTCTTCATTAAGCATCCTGTTCCTGGATGAAAACAAAAATGTTGTCCTTAAAGTTTATCCCAACATGACAGTGGAGTCTTGTGCCTGTAGATGATATCTTCAAATGCCTACTGAAAAAAGGGAAAAGGTGTTAAAAGCAATCTTCAGTTTTGCACTTTTAGTATATCACATNGAAATGAATTGTCAGTGGCAGACAAAACATTATATAGC
  5   1   2       bld AbdN                               IMAGE:7003801                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAATGACTCTGCAATTTCAGAGCCTGACAGTGTTGTTTCCAGTTTGCATGGGCCACATACTCCTCTAACTCTCAAACCAAACCGGAAAATAGAAAAAGCTGAACAAAGAAAAAAACGATCTACAGACATTCTTTTACCCTTACAAAACAACGAGCTCCCTGGTGCAGAATACCAGTACAGTGTGGATGAAGAGGGTTGGGAAGAAAGAAAACCCTACAAAACTTTTCAGGGACGTCAGAATGAGAAGGATAAAAATAAGAAAAAGCTTAGGAAAAGCAACCGTCAGAAGAGCCAAACACTTCAGTTCGATGAACAGACCTTGAAGAAAGCAAGAAGAAAGCAGTGGAACGAACCACGAAATTGTGCACGGCGTTATCTAAAAGTCGACTTTGCAGACATTGGCTGGAGTGAATGGATTATTTCCCCCAAATCCTTTGATGCATATTACTGCTCAGGTGCATGCCAGTTTCCAATGCCAAAGTCTTTAAAACCTTCGAATCATGCTACTATCCAGAGCATTGTAAGAGCGGTTGGTGTGGTACCTGGAATACCTGAGCCGTGCTGTGTGCCAGAAAAAATGTCTTCATAAAGCATCCTGTTCCTGGATGAAAACAAAAATGTTGTCCTTAAAGTTTATCCCAACATGACAGTGGAGTCTTGTGCCTGTAGATGATATCTTCAAATGCCTACTGAANAAAGGGAAAAGGTGTTAAAAGCAATCTTCAGTTTTGCACTTTTAGTATATCACATGAAAATGAAATGTCAGTGGCAGACAAAACATTATATAGCANAAAAAAACACTGGTTTTTGGCCTCCTGCTATAGACAAGGAGGGAAATATGGACCGTGATATAAACATGCCAGAAGCCTTACAGACAACAGATATTTCTCTTTTCAAGAGGACTGGGATTTTTATTTTTCCAAACCTCCAAAGATGCCCCTAATTTTGGTAACCAGGAAAAATT
  5   1   2      seed Gas7      in                         XZG34472.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACAATGAGCTCCCTGGTGCAGAATACCAGTACAGTGTGGATGAAGAGGGTTGGGAAGAAAGAAAACCCTACAAAACTCTTCAGGGACGTCAGAATGAGAAGGATAAAAATAAGAAAAAGCTTAGGAAAAGCAACCGTCAGAAGAGCCAAACACTTCAGTTCGATGAACAGACCTTGAAGAAAGCAAGAAGAAAGCAGTGGAACGAACCACGAAATTGTGCATGGCGTTATCTAAAAGTCGACTTTGCAGACATTGGCTGGAGTGAATGGATTATTTCCCCCAAATCCTTTGATGCATATTACTGCTCAGGTGCATGCCAGTTTCCAATGCCAAAGTCTTTAAAACCTTCGAATCATGCTACTATCCAGAGCATTGTAAGAGCGGTTGGTGTGGTACCTGGAATACCTGAGCCGTGCTGTGTGCCAGAAAAAATGTCTTCATTAAGCATCCTGTTCCTGGATGAAAACAAAAATTTTGTCCTTAAAGTTTATCCCAACATGACAGTGGAGTCTTGTGCCTGTAGATGATATCTTCAAATGCCTACTGAAAAAAGGGAAAAGGTGTTAAAAGCAATCTTCAGTTTTGCACTTTTAGTATATCACATGAAAATGAATTGTCAGTGGCAGACAAAACATTATATAGCAAAAAAAAAAACACTGGTTTTTGGCCTCTGCTTATAGACAAGGAGGGAAATATGGAACCGTGATATAAACATGCCAGAAGCCATACAGACAACAGATATTTCTCTTTTCAAGATGACTGGATTTTTATTTTTCAAACCTCCAAAGATGCACCTATTTTTGTACCAGGAAAAAATAACCTGTAGCTATTGTTCTGTGCCTTCAGAAT
  3   1   2       bld Gas7      in                         XZG34472.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCTTCATTAAGCATCCTGTTCCTGGATGAAAACAAAAATTTTGTCCTTAAAGTTTATCCCAACATGACAGTGGAGTCTTGTGCCTGTAGATGATATCTTCAAATGCCTACTGAAAAAAGGGAAAAGGTGTTAAAAGCAATCTTCAGTTTTGCACTTTTAGTATATCACATGAAAATGAATTGTCAGTGGCAGACAAAACATTATATAGCAAAAAAAAAAACACTGGTTTTTGGCCTCTGCTTATAGACAAGGAGGGAAATATGGAACCGTGATATAAACATGCCAGAAGCCATACAGACAACAGATATTTCTCTTTTCAAGATGACTGGATTTTTATTTTTCAAACCTCCAAAGATGCACCTATTTTTGTACCAGGAAAAATTAACCTGTAGCTATTGTTCTGTGCCTTCAGAATTATTGGTTTCTAGCTGGTGAATCTAATTTCATATATAAATGGCCAAACATTTATTTAAACGGCTGGTATTTTTTTTCCACAAATACCAATGTCTGTTTCTATACAATGAACAGGAAAATAAATATTTTCATGCTTACACTGCAAGTTGTGCATGCAAAGAATTTTTTTTAAATCTTAGTAAATGTATATAATCTGAAAATATACAAGTTTCTTATCAATACAATATGCAACATTTCAGGTGTAAATTAACTGTAAAATAAACTGATGAATTGTCAAAAAAAAAATAAAGAAGAAGAAATGAAAGAAGCAACAACTAAATAGAAAAAAAAAATCGCAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)