Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:5307157.5                       9 END     3         100       42                UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012096157 Xt7.1-ANBT2480.3 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-ANBT2480.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAAGTGGAAAGAGAGTTCTTGGGTGCTGTGTGATTACTATCTGCCCTACGCACTGGGTGGGGGCTACGTGATCTCCTGGGATCTAGTGCGCTATCTGAGCCTCAGCCAGGACTTCCTGGCACATTGGCAGAGTGAAGACGTGTCCCTGGGGGCATGGTTGGCACCTCTGGAGCTCAAGCGGCTGCACGACCCCCGATTTGATACCGAGTACAAGTCCAGGGGCTGCAATAACAAGTACTTAGTAACCCACAAGCAGAGCATCGAGGACATGTTAGAAAAGCATCAGACATTGGCTAAAGAAGGCAGGCTGTGCAAGGAAGAGATCAAACTAAGGCTTTCCTATATCTATGACTGGGATGTACCACCATCCCAATGTTGCCAGAGGAAGGATGGCATTCCCTGAGCCCTCCTTTTGGTTTTAGGACTGCCAAGTGATGTAGTGTTGCTGGTAGGGTTGCTGCCTTTTCTTGGAAAAGAATACCGGCATTCCTATATTTTTAGCTGTCTTTCTTATTAATGACATAGGCATCAAGCATTATTATAACCAGCCAGACTGGTTAAATACAGCGATGTGGCAACCCTGCGTGGTGGTGAGCACTACACTGAAACAAAATGTAATATGAGTCCCCCTCCATAGGGTTCGGGCTTTTAAAGGTGTGTGTGAGATCCATAAAAATAACACAGGCATACTGAGCATTTATCCGGCATATCCAGTCAACACCCATCCAGATGTAGCATGAAATATGGCATCTTTTCATTGGGGACAAGGTGGGGTTGTACTTGGTAGTAGTAACAAATTTTCGTTTTGTCTCTTCATATGTTTTCTTTTAAAGTTGTTTTTTTAACTTCCTATTTTGTCTCTTGTCAGCCTCCAGCTAGAAATGCTATCAAGTTGTTGGGGTCCCAGATCCCCTACAGCCCTTAAAAAAAACAA
                                                  Xt7.1-CHK-1008247250                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAAAGAGAGTTCTTGGGTGCTGTGTGATTACTATCTGCCCTACGCACTGGGTGGGGGCTACGTGATCTCCTGGGATCTAGTGCGCTATCTGAGCCTCAGCCAGGACTTCCTGGCACATTGGCAGAGTGAAGACGTGTCCCTGGGGGCATGGTTGGCACCTCTGGAGCTCAAGCGGCTGCACGACCCCCGATTTGATACCGAGTACAAGTCCAGGGGCTGCAATAACAAGTACTTAGTAACCCACAAGCAGAGCATCGAGGACATGTTAGAAAAGCATCAGACATTGGCTAAAGAAGGCAGGCTGTGCAAGGAAGAGATCAAACTAAGGCTTTCCTATATCTATGACTGGGATGTACCACCATCCCAATGTTGCCAGAGGAAGGATGGCATTCCCTGAGCCCTCCTTTTGGTTTTAGGACTGCCAAGTGATGTAGTGTTGCTGGTAGGGTTGCTGCCTTTTCTTGGAAAAGAATACCGGCATTCCTATATTTTTAGCTGTCTTTCTTATTAATGACATAGGCATCAAGCATTATTATAACCAGCCAGACTGGTTAAATACAGCGATGTGGCAACCCTGCGTGGTGGTGAGCACTACACTGAAACAAAATGTAATATGAGTCCCCCTCCATAGGGTTCGGGCTTTTAAAGGTGTGTGTGAGATCCATAAAAATAACACAGGCATACTGAGCATTTATCCGGCATATCCAGTCAACACCCATCCAGATGTAGCATGAAATATGGCATCTTTTCATTGGGGACAAGGTGGGGTTGTACTTGGTAGTAGTAACAAATTTTCGTTTTGTCTCTTCATATGTTTTCTTTTAAAGTTGTTTTTTTAACTTCCTATTTTGTCTCTTGTCAGCCTCCAGCTAGAAATGCTATCAAGTTGTTGGGGTCCCAGATCCCCTACAGCCCTTAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                                                       ...PROTEIN --- Xl ---- 8e-009     AAH70684.1 MGC83081 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 8e-009     NP_001084830.1 hypothetical protein LOC431874 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 5e-026     NP_610399.1 CG8734-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 2e-043     CAJ84709.1 beta-1,3-galactosyltransferase 6 [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 5e-043     NP_494394.1 beta 1 3-galactosyltransferase polypeptide 6 precursor (38.0 kD) (2D180)[Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 7e-045     XP_001177494.1 PREDICTED: similar to beta-1,3-galactosyltransferase 6 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Cs ---- 2e-046     CAJ84710.1 beta-1,3-galactosyltransferase 6 [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 3e-060     NP_536693.1 UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6;UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 6 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 2e-062     NP_542172.2 UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 1e-067     NP_001038690.1 similar to UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Gg ---- 3e-069     XP_425743.1 PREDICTED: similar to UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6; beta-1,3-galactosyltransferase-6; UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 6 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 6e-079     AAH90565.1 Unknown (protein for MGC:69183) [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-ANBT2480.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------TAATGA---------------------TAA---------------------------------------------------------------------------ATG------------TAG------------TAA---------TGA------TAA---TAA---------------------------------------------------------ATG---------------------------------------------TAGTAGTAA------------------------ATG------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                            ]
  3   1   2       bld Egg  5g3  ?                     TEgg044h06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAAGTGGAAAGAGAGTTCTTGGGTGCTGTGTGATTACTATCTGCCCTACGCACTGGGTGGGGGCTACGTGATCTCCTGGGATCTAGTGCGCTATCTGAGCCTCAGCCAGGACTTCCTGGCACATTGGCAGAGTGAAGACGTGTCCCTGGGGGCATGGTTGGCACCTCTGGAGCTCAAGCGGCTGCACGACCCCCGATTTGATACCGAGTACAAGTCCAGGGGCTGCAATAACAAGTACTTAGTAACCCACAAGCAGAGCATCGAGGACATGTTAGAAAAGCATCAGACATTGGCTAAAGAAGGCAGGCTGTGCAAGGAAGAGATCAAACTAAGGCTTTCCTATATCTATGACTGGGATGTACCACCATCCCAATGTTGCCAGAGGAAGGATGGCATTCCCTGAGCACTCCTTTTGGTTTTAGGACTGCCAAGTGATGTAGTGTTGCTGGTAGGGTTGCTGCCTTTTCTTGGAAAAGAATACCGGCATTCCTATATTTTTAGCTGTCTTTCTTATTAATGACATAGGCATCAAGCATTATTATAACCAGCCAGACTGGTTAAATACAGCGATGTGGCAACCCTGCGTGGTGGTGAGCACTACACTGAAACAAAATGTAATATGAGTCCCCCTCCATAGGGTTCGGGCTTTTAAAGGTGTGTGTGAGATCCATAAAAATAACACAGGCATACTGAGCATTTATCCGGCATATCCAGTCAACACCCATCCAGATGTAGCATGAAATATGGCATCTTTTCATTGGGGACAAGGTGGGGTTGTACTTGGTAGTAGTAACAAATTTTCGTTTTGTCTCTTCATATGTTTTCTTTTAAAGTTGTTTTTTTAACTTCCTATTTTGTCTCTTGTCAGCCTCCAGCTAGAAATGCTATCAAGTTGTTGGGGTCCCAGATCCCCTACAGCCCTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  out                        CCAX2709.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAGCTCAAGCGGCTGCACGACCCCCGATTTGATACCGAGTACAAGTCCAGGGGCTGCAATAACAAGTACTTAGTAACCCCACAAGCAGAGCATCGAGGACATGTTAGAAAAGCATCAGACATTGGCTAAAGAAGGCAGGCTGTGCAAGGAAGAGATCAAACTAAGGCTTTCCTATATCTATGACTGGGATGTACCACCATCCCAATGTTGCCAGAGGAAGGATGGCATTCCCTGAGCCCTCCTTTTGGTTTTAGGACTGCCAAGTGATGTAGTGTTGCTGGTAGGGTTGCTGCCTTTTCTTGGAAAAGAATACCGGCATTCCTATATTTTTAGCTGTCTTTTTTATTAATGACATAGGCATCAAGCATTATTATAACCAGCCAGACTGGTTAAATACAGCGATGTGGCAACCCTGCGTGGTGGTGAGCACTACACTGAAACAAAATGTAATATGAGTCCCCCTCCATAGGGTTCGGGCTTTTAAAGGTGTGTGTGAGATCCATAAAAATAACACAGGCATACTGAGCATTTATCCGGCATATCCAGTCAACACCCATCCAGATGTAGCATGAAATATGGCATCTTTTCATTGGGGACAAGGGGGGGTTGTACTTGGTAGTAGTAACAAATTTTCGTTTTGTCTCTTCATATGTTTTTTTTTAAAGTTGTTTTTTTAACTTC
  3   1   2      seed Gas6      out                        ANBT2480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGTACAAGTCCAGGGGCGGCAATAACAAGTACTTAGTAACCCACAAGCAGAGCATCGAGGACATGTTAGAAAAGCATCAGACATTGGCTAAAGAAGGCAGGCTGTGCAAGGAAGAGATCAAACTAAGGCTTTCCTATATCTATGACTGGGATGTACCACCATCCCAATGTTGCCAGAGGAAGGATGGCATTCCCTGAGCCCTCCTTTTGGTTTTAGGACTGCCAAGTGATGTAGTGTTGCTGGTAGGGTTGCTGCCTTTTCTTGGAAAAGAATACCGGCATTCCTATATTTTTAGCTGTCTTTCTTATTAATGACATAGGCATCAAGCATTATTATAACCAGCCAGACTGGTTAAATACAGCGATGTGGCAACCCTGCGTGGTGGTGAGCACTACACTGAAACAAAATGTAATATGAGTCCCCCTCCATAGGGTTCGGGCTTTTAAAGGTGTGTGTGAGATCCATAAAAATAACACAGGCATACTGAGCATTTATCCGGCATATCCAGTCAACACCCATCCAGATGTAGCATGAAATATGGCATCTTTTCATTGGGGACAAGGTGGGGTTGTACTTGGTAGTAGTAACAAATTTTCGTTTTGTCTCTTCATATGTTTTCTTTTAAAGTTGTTTTTTTAACTTCCTATTTTGTCTCTTGTCAGCCTCCAGCTAGAAATGCTATCAAGTTGTTGGGGTCCCAGATCCCCTACAGCCCTTAAAAAAAACAAAAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)