Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABE5643.3                           77 END     1          33        1                Hip1-prov protein [Xenopus laevis]
     2   2.0    0Xt7.1-CABI10302.5.5                        74 END     1          33        1                microtubule-associated protein 1 light chain 3 gamma [Xenopus tropicalis]
     3   2.0    0Xt7.1-CAAK6312.5                            7 END     1          33       16                Hip1-prov protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012096433 Xt7.1-XZG37220.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG37220.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAACGGGCATCAGACATGCTGTACTTCAAGCGGCTCATTCAGATTCCCCGTCTTCCTGATGGTCCACCCAACTTTTTGCGAGCCTCTGCCCTTGCAGAGCATGTTAAACCAGTGGTTGTTATCCCCAATGAAACTCCAGAAGATGAGGAGCCAGCAGAATCATTGATTGAGATCAGCGCAGCTCAGCCTGTGGAGCAGGAGCAGGTTGTGGAAGACTTATTTCAGCAAACCTTTGGTGCTCCTAATGGTCTTATGAAAGATGACAGGGATCTTCAAATTGAAAATCTGCAAAAGGAAATAGAATTACTACGTGCTGAACTAGAGAAAATAAAGCTGGAGGCACAAAAGTACATCTTGCAACTAAAAGGACAAATCAACACATTGGAGGCTGAGCTAGAGGAACAGAGGAAGCAGAAACAAAAGGCTTTAGTAGATAATGAACAGTTGCGGGATGAGTTGGAGAAGCTAAAGAAACAGAAACTGGAAAATGAGAAAACACAAGGGGTCCTCCTGGAAGCAGAGAAGAAGATACAAGCCACAGAGTTACGCTATACCAAACTGAAAGAAAAGCACAATGAGCTCATTAATACCCACGCTGGACTTCTTAGAAAGAATGCTGATACAGCAAAACAGTTAACAGTGTCACAACAAAATCAGGAAGAGGTGGCACGTATCAAAGAAGAGCTGGAATTTCAGATGGATCAAGTGAAACGAGAATCAGATTTGAAGTTGGAGGACCAAAGTTTTCAGACTGAACAACTGAAATCAGAAATTGAAGCAAAGAAAAAAGAGTTATTACTTATCCAGCAATCTCTATCAAGTACTGAGGAGTCTAAATCCCAGCTTAACTCAACATTAATGTCACTAGAAGTGGAGAAGGACACTCTAAAAAGTTTGTTGACCACTAAGGAATCGGAACTGTCTTCTGCTCAAAACCTGGCTCGAGATACAGAGACTTTATTCAATCAAGAGCAAGAAAAGAAAGCCAGTGAAATAAGAGACTTGCACGAAAAACTCAACAAAAAGACTACTGATGAACAGAAGCTTTATCAGAAGATGTTAGAGGATCAGTTTAACAT
                                                  Xt7.1-CHK-1008250242                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCATCAGACATGCTGTACTTCAAGCGGCTCATTCAGATTCCCCGTCTTCCTGATGGTCCACCCAACTTTTTGCGAGCCTCTGCCCTTGCAGAGCATGTTAAACCAGTGGTTGTTATCCCCAATGAAACTCCAGAAGATGAGGAGCCAGCAGAATCATTGATTGAGATCAGCGCAGCTCAGCCTGTGGAGCAGGAGCAGGTTGTGGAAGACTTATTTCAGCAAACCTTTGGTGCTCCTAATGGTCTTATGAAAGATGACAGGGATCTTCAAATTGAAAATCTGCAAAAGGAAATAGAATTACTACGTGCTGAACTAGAGAAAATAAAGCTGGAGGCACAAAAGTACATCTTGCAACTAAAAGGACAAATCAACACATTGGAGGCTGAGCTAGAGGAACAGAGGAAGCAGAAACAAAAGGCTTTAGTAGATAATGAACAGTTGCGGGATGAGTTGGAGAAGCTAAAGAAACAGAAACTGGAAAATGAGAAAACACAAGGGGTCCTCCTGGAAGCAGAGAAGAAGATACAAGCCACAGAGTTACGCTATACCAAACTGAAAGAAAAGCACAATGAGCTCATTAATACCCACGCTGGACTTCTTAGAAAGAATGCTGATACAGCAAAACAGTTAACAGTGTCACAACAAAATCAGGAAGAGGTGGCACGTATCAAAGAAGAGCTGGAATTTCAGATGGATCAAGTGAAACGAGAATCAGATTTGAAGTTGGAGGACCAAAGTTTTCAGACTGAACAACTGAAATCAGAAATTGAAGCAAAGAAAAAAGAGTTATTACTTATCCAGCAATCTCTATCAAGTACTGAGGAGTCTAAATCCCAGCTTAACTCAACATTAATGTCACTAGAAGTGGAGAAGGACACTCTAAAAAGTTTGTTGACCACTAAGGAATCGGAACTGTCTTCTGCTCAAAACCTGGCTCGAGATACAGAGACTTTATTCAATCAAGAGCAAGAAAAGAAAGCCAGTGAAATAAGAGACTTGCACGAAAAACTCAACAAAAAGACTACTGATGAACAGAAGCTTTATCAGAAGATGTTAGAGGATCAGTTTAACATTATTCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       ...PROTEIN --- Bf ---- 8e-007     CAA11444.1 intermediate filament protein C1 [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 2e-012     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-012     AAI21248.1 Unknown (protein for IMAGE:7658342) [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sc ---- 2e-013     NP_014859.1 Relieves uso1-1 transport defect; golgin-160 related protein; Rud3p[Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 6e-015     NP_729827.1 CG10971-PB, isoform B [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 2e-017     NP_498925.1 huntingtin interacting protein 1 (3J813) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 4e-029     XP_785542.2 PREDICTED: similar to huntingtin interacting protein 1 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 3e-062     XP_699759.1 PREDICTED: similar to Hip1-prov protein, partial [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 4e-122     NP_001025828.1 huntingtin interacting protein-1-related [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Hs ---- 7e-126     XP_001132864.1 PREDICTED: similar to Huntingtin-interacting protein 1-related protein (Hip1-related) (Hip 12) [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN --- Mm ---- 4e-126     NP_659507.2 huntingtin interacting protein 1 related [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 0          AAH77182.1 Hip1-prov protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN --- ?? ---- 0          NP_001086615.1 huntingtin interacting protein 1 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG37220.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  3   1   2       bld BrSp FL   out                    EC2BBA24DH12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAACGGGCATCAGACATGCTGTACTTCAAGCGGCTCATTCAGATTCCCCGTCTTCCTGATGGTCCACCCAACTTTTTGCGAGCCTCTGCCCTTGCAGAGCATGTTAAACCAGTGGTTGTTATCCCCAATGAAACTCCAGAAGATGAGGAGCCAGCAGAATCATTGATTGAGATCAGCGCAGCTCAGCCTGTGGAGCAGGAGCAGGTTGTGGAAGACTTATTTCAGCAAACCTTTGGTGCTCCTAATGGTCTTATGAAAGATGACAGGGATCTTCAAATTGAAAATCTGCAAAAGGAAATAGAATTACTACGTGCTGAACTAGAGAAAATAAAGCTGGAGGCACAAAAGTACATCTTGCAACTAAAAGGACAAATCAACACATTGGAGGCTGAGCTAGAGGAACAGAGGAAGCAGAAACAAAAGGCTTTAGTAGATAATGAACAGTTGCGGGATGAGTTGGAGAAGCTAAAGAAACAGAAACTGGAAAATGAGAAAACACAAGGGGTCCTCCTGGAAGCAGAGAAGAAGATACAAGCCACAGAGTTACGCTATACCAAACTGAAAGAAAAGCACAATGAGCTCATTAATACCCACGCTGGACTTCTTAGAAAGAATGCTGATACAGCAAAACAGTTAACAGTGTCACAACAAAATCAGGAAGAGGTGGCACGTATCAAAGAAGAGCAGGAATTTCAGATGGATCAAGTGAAACGA
  5   1   2       bld Gas  5x3  out                  TGas054b02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAGCCTCTGCCCTTGCAGAGCATGTTAAACCAGTGGTTGTTATCCCCAATGAAACTCCAGAAGATGAGGAGCCAGCAGAATCATTGATTGAGATCAGCGCAGCTCAGCCTGTGGAGCAGGAGCAGGTTGTGGAAGACTTATTTCAGCAAACCTTTGGTGCTCCTAATGGTCTTATGAAAGATGACAGGGATCTTCAAATTGAAAATCTGCAAAAGGAAATAGAATTACTACGTGCTGAACTAGAGAAAATAAAGCTGGAGGCACAAAAGTACATCTTGCAACTAAAAGGACAAATCAACACATTGGAGGCTGAGCTAGAGGAACAGAGGAAGCAGAAACAAAAGGCTTTAGTAGATAATGAACAGTTGCGGGATGAGTTGGAGAAGCTAAAGAAACAGAAACTGGAAAATGAGAAAACACAAGGGGTCCTCCTGGAAGCAGAGAAGAAGATACAAGCCACAGAGTTACGCTATACCAAACTGAAAGAAAAGCACAATGAGCTCATTAATACCCACGCTGGAC
  5   1   2      seed Gas7      out                        XZG37220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATCAACACATTGGAGGCTGAGCTAGAGGAACAGAGGAAGCAGAAACAAAAGGCTTTAGTAGATAATGAACAGTTGCGGGATGAGTTGGAGAAGCTAAAGAAACAGAAACTGGAAAATGAGAAAACACAAGGGGTCCTCCTGGAAGCAGAGAAGAAGATACAAGCCACAGAGTTACGCTATACCAAACTGAAAGAAAAGCACAATGAGCTCATTAATACCCACGCTGGACTTCTTAGAAAGAATGCTGATACAGCAAAACAGTTAACAGTGTCACAACAAAATCAGGAAGAGGTGGCACGTATCAAAGAAGAGCTGGAATTTCAGATGGATCAAGTGAAACGAGAATCAGATTTGAAGTTGGAGGACCAAAGTTTTCAGACTGAACAACTGAAATCAGAAATTGAAGCAAAGAAAAAAGAGTTATTACTTATCCAGCAATCTCTATCAAGTACTGAGGAGTCTAAATCCCAGCTTAACTCAACATTAATGTCACTAGAAGTGGAGAAGGACACTCTAAAAAGTTTGTTGACCACTAAGGAATCGGAACTGTCTTCTGCTCAAAACCTGGCTCGAGATACAGAGACTTTATTCAATCAAGAGCAAGAAAAGAAAGCCAGTGAAATAAGAGACTTGCACGAAAAACTCAACAAAAAGACTACTGATGAACAGAAGCTTTATCAGAAGATGTTAGAGGATCAGTTTAACATTATTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)