Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK7057.3                           17 END     2          50       11                PREDICTED: similar to C21orf25 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012096635 Xt7.1-CAAK7057.5 - 4 ESTs
                                                                       -430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK7057.5                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCTGAGCAGCTGGAGGAGCCAGTGGCTGAAAGCTTGGATAGATGCCCTCAATGCCGAAGCTGGAAAAAGAGGAGGAACCCTTAGGCTGTCTTTTGAGGATGCCAATGGCCAACATCCGTTGGAGCTGTCGGTGAAAGAAGTAACGAGTGTTGTGAAATCAGACAAAGAGAAGGTTGTATCATGCAATGTGATTGGAGATTCCATACAGTTTACAGTGCGTGTCACTCGCACCGTCCCGGCCAACTCAGGATGCCAGGTGTACAGCGTCCGGGTCACCCCTCTCCAGCTCAATCTGGAGCTGCACATGAAAGAGGAAAACAGTGGGAACATTCAGGTCCTCTGGACCATGGGGAACTTTGCAAACCTCAATCTTCAGGTTCAGCCAAGGAGCAAAATCGAGACCCCTGGAGCCAGTGCAGTATTGGAAACCCTTGAAGATATACTGAAGAACTTGATGACGTTGGTCCAACCATCAGTAGATCTCAGCACCAGGCCCACAGGAAATATTCATGGAGCCAGTTCTCAGTTAATGTGCCCTCCCAAGCCACCGAGAGTTCACGACTTGAAGCTTCAGCTGAAGGGGCTCCAAGCAACACTATCTGGAGATGACCTATCAGGGATCTCAAGTACAGCCTGCACCGTGCAGATAAACGACCCCATCCAGAAAGTCACTACAGCAGCCACAAACACTACCAGTCCGTCTTGGGAAGAAGAATTCATCTTTGAGCTCAGTGCTAAATCCAGGGAGCTTCAGTTGCAGATTGTGGAAGCAGGGAAGTCCCCAGAGGGTGCCCCTCTAGCCTCAGCGAATGTGCCCTTGGATCTGTTCCATAAGCAGCCAACAGGGCGGCAGAGTTTCCCCCTGAGAAGCGTATCTGGCAAGGCTGTGTGTGGATCGGTCAGTGCGCAGTTCCTTTATATTGAACCAAGCGAGGGAAAATCCTGGACAATTCCGACACCAGTGGCTGCCAAAAAGGTAGAGAAGGATCGGACGGTGATGCCTTGTGGGACAGTGGTCACCACTGTGACATCGGTGATCTCAAAGCCTCGGCTGGATGGGAAGAGCCCAACTCAGAGCAATGATTCCCCTGCAAAGACACCCCCTAAAATCAAGGTGATAGGAAGGGACTTCTCTGTGCAAGCAATGCCTTCTGAGAGCACTGTGGTCAGCAAAGCCTTGTCATCGTCCGACACAGAGCTTTTGTTTCTGAATGGCTCAGATCCCGTTGCAGAAGCTGCTATCCGCCAGCTCCGGGAATCCTCCAAACAGTCATTTAAGTCTCCAAGAAAGAAGAGCACCATTATTATATCAGGGATCTCCAAGACTGCCGTATCTCACGACGAAGAGGCATCACTTATGTTCAATTATGCCGAGGCCATGGACAACTCAGTTATGAACTCTCCCCATTCTGTGTATGAAAGTGCCACCCCCCACATCAGCTGCAGATATAGACCAGTTGGAGGTCTCTGTGCCAACCCTACCATCTCCAGTCTCAGAAGATGAGCTTCTTGGTACATGGGAGCAAGGCAGTGAGCTGGAGGAGTGGAATATCAATGGTTTGGAGGACCCAGACTGTGAAGAATGTCCATCAGCAACCTGAGCGTCTCTGAAACGGGAAGCATGAAGAAATCCAAGGTGGATTTTTAAAGAAAGGGCAAGCTCTTTTTCTATGAGCACAGCGAAGGAGCAGCATGATCAGTTCCAAAATGACTTCGTCTTACTGTGT
                                                  Xt7.1-CHK-1008247139                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCTGGAGGAGCCAGTGGCTGAAAGCTTGGATAGATGCCCTCAATGCCGAAGCTGGAAAAAGAGGAGGAACCCTTAGGCTGTCTTTTGAGGATGCCAATGGCCAACATCCGTTGGAGCTGTCGGTGAAAGAAGTAACGAGTGTTGTGAAATCAGACAAAGAGAAGGTTGTATCATGCAATGTGATTGGAGATTCCATACAGTTTACAGTGCGTGTCACTCGCACCGTCCCGGCCAACTCAGGATGCCAGGTGTACAGCGTCCGGGTCACCCCTCTCCAGCTCAATCTGGAGCTGCACATGAAAGAGGAAAACAGTGGGAACATTCAGGTCCTCTGGACCATGGGGAACTTTGCAAACCTCAATCTTCAGGTTCAGCCAAGGAGCAAAATCGAGACCCCTGGAGCCAGTGCAGTATTGGAAACCCTTGAAGATATACTGAAGAACTTGATGACGTTGGTCCAACCATCAGTAGATCTCAGCACCAGGCCCACAGGAAATATTCATGGAGCCAGTTCTCAGTTAATGTGCCCTCCCAAGCCACCGAGAGTTCACGACTTGAAGCTTCAGCTGAAGGGGCTCCAAGCAACACTATCTGGAGATGACCTATCAGGGATCTCAAGTACAGCCTGCACCGTGCAGATAAACGACCCCATCCAGAAAGTCACTACAGCAGCCACAAACACTACCAGTCCGTCTTGGGAAGAAGAATTCATCTTTGAGCTCAGTGCTAAATCCAGGGAGCTTCAGTTGCAGATTGTGGAAGCAGGGAAGTCCCCAGAGGGTGCCCCTCTAGCCTCAGCGAATGTGCCCTTGGATCTGTTCCATAAGCAGCCAACAGGGCGGCAGAGTTTCCCCCTGAGAAGCGTATCTGGCAAGGCTGTGTGTGGATCGGTCAGTGCGCAGTTCCTTTATATTGAACCAAGCGAGGGAAAATCCTGGACAATTCCGACACCAGTGGCTGCCAAAAAGGTAGAGAAGGATCGGACGGTGATGCCTTGTGGGACAGTGGTCACCACTGTGACATCGGTGATCTCAAAGCCTCGGCTGGATGGGAAGAGCCCAACTCAGAGCAATGATTCCCCTGCAAAGACACCCCCTAAAATCAAGGTGATAGGAAGGGACTTCTCTGTGCAAGCAATGCCTTCTGAGAGCACTGTGGTCAGCAAAGCCTTGTCATCGTCCGACACAGAGCTTTTGTTTCTGAATGGCTCAGATCCCGTTGCAGAAGCTGCTATCCGCCAGCTCCGGGAATCCTCCAAACAGTCATTTAAGTCTCCAAGAAAGAAGAGCACCATTATTATATCAGGGATCTCCAAGACTGCCGTATCTCACGACGAAGAGGCATCACTTATGTTCAATTATGCCGAGGCCATGGACAACTCAGTTATGAACTCTCCCCATTCTGTGTATGAAAGTGCCACCCCCCACATCAGCTGCAGATATAGACCAGTTGGAGGTCTCTGTGCCAACCCTACCATCTCCAGTCTCAGAAGATGAGCTTCTTGGTACATGGGAGCAAGGCAGTGAGCTGGAGGAGTGGAATATCAATGGTTTGGAGGACCCAGACTGTGAAGAATGTCCATCAGCAACCTGAGCGTCTCTGAAACGGGAAGCATGAAGAAATCCAAGGTGGATTTTTAAAGAAAGGGCAAGCTCTTTTTCTATGAGCACAGCGAAGGAGCAGCATGATCAGTTCCAAAATGACTTCGTCTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                    1     1     1     1     1     1     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       PREDICTED - Sp ---- 8e-022     XP_001196546.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 2e-053     AAI30099.1 Unknown (protein for IMAGE:5047495) [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 2e-082     XP_694813.1 PREDICTED: hypothetical protein XP_689721 [Danio rerio] ---------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PREDICTED - Mm ---- 3e-125     NP_777272.1 RIKEN cDNA 5830404H04; EST BF168443 [Mus musculus] -----------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PREDICTED - Hs ---- 2e-131     NP_056315.1 hypothetical protein LOC25966 isoform 1 [Homo sapiens] -------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 1e-136     XP_416741.2 PREDICTED: similar to C21orf25 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK7057.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------ATG---------------------------------------------------------------------------------------------------------TGA------------ATG------------TGA------------------------------------------TGA---ATG------------------------------------ATG---------------------TAA---------------------------------------------TGA------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2      seed Neu                            TNeu014a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCTGAGCAGCTGGAGGAGCCAGTGGCTGAAAGCTTGGATAGATGCCCTCAATGCCGAAGCTGGAAAAAGAGGAGGAACCCTTAGGCTGTCTTTTGAGGATGCCAATGGCCAACATCCGTTGGAGCTGTCGGTGAAAGAAGTAACGAGTGTTGTGAAATCAGACAAAGAGAAGGTTGTATCATGCAATGTGATTGGAGATTCCATACAGTTTACAGTGCGTGTCACTCGCACCGTCCCGGCCAACTCAGGATGCCAGGTGTACAGCGTCCGGGTCACCCCTCTCCAGCTCAATCTGGAGCTGCACATGAAAGAGGAAAACAGTGGGAACATTCAGGTCCTCTGGACCATGGGGAACTTTGCAAACCTCAATCTTCAGGTTCAGCCAAGGAGCAAAATCGAGACCCCTGGAGCCAGTGCAGTATTGGAAACCCTTGAAGATATACTGAAGAACTTGATGACGTTGGTCCAACCATCAGTAGATCTCAGCACCAGGCCCACAGGAAATATTCATGGAGCCAGTTCTCAGTTAATGTGCCCTCCCAAGCCACCGAGAGTTCACGACTTGAAGCTTCAGCTGAAGGGGCTCCAAGCAACACTATCTGGAGATGACCTATCANGGATCTCAAGTACAGCCTGCACCGTGCAGATAAACGACCCCATCCAGAAAGTCACTACAGCAGCCACAAACACTA
  5   1   2       bld Brn3      out                        CAAK7057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCGTCGGCCCCAGTGCGGCGGTGCCTGTGCCAGAATATTGCAGGGAACCCTTAGGCTGTCTTTTGAGGATGCCAATGGCCAACATCCGTTGGAGCTGTCGGTGAAAGAAGTAACGAGTGTTGTGAAATCAGACAAAGAGAAGGTTGTATCATGCAATGTGATTGGAGATTCCATACAGTTTACAGTGCGTGTCACTCGCACCGTCCCGGCCAACTCAGGATGCCAGGTGTACAGCGTCCGGGTCACCCCTCTCCAGCTCAATCTGGAGCTGCACATGAAAGAGGAAAACAGTGGGAACATTCAGGTCCTCTGGACCATGGGGAACTTTGCAAACCTCAATCTTCAGGTTCAGCCAAGGAGCAAAATCGAGACCCCTGGAGCCAGTGCAGTATTGGAAACCCTTGAAGATATACTGAAGAACTTGATGACGTTGGTCCAACCATCAGTAGATCTCAGCACCAGGCCCACAGGAAATATTCATGGAGCCAGTTCTCAGTTAATGTGCCCTCCCAAGCCACCGAGAGTTCACGACTTGAAGCTTCAGCTGAAGGGGCTCCAAGCAACACTATCTGGAGATGACCTATCAGGGATCTCAAGTACAGCCTGCACCGTGCAGATAAACGACCCCATCCAGAAAGTCACTACAGCAGCCACAAACACTACCCAGTCCGTCTTTGGGA
  5   1   2       bld Mus1      out                        CABH8313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAACTCAGGATGCCAGGTGTACAGCGTCCGGGTCACCCCTCTCCAGCTCAATCTGGAGCTGCACATGAAAGAGGAAAACAGTGGGAACATTCAGGTCCTCTGGACCATGGGGAACTTTGCAAACCTCAATCTTCAGGTTCAGCCAAGGAGCAAAATCGAGACCCCTGGAGCCAGTGCAGTATTGGAAACCCTTGAAGATATACTGAAGAACTTGATGACGTTGGTCCAACCATCAGTAGATCTCAGCACCAGGCCCACAGGAAATATTCATGGAGCCAGTTCTCAGTTAATGTGCCCTCCCAAGCCACCGAGAGTTCACGACTTGAAGCTTCAGCTGAAGGGGCTCCAAGCAACACTATCTGGAGATGACCTATCAGGGATCTCAAGTACAGCCTGCACCGTGCAGATAAACGACCCCATCCAGAAAGTCACTACAGCAGCCACAAACACTACCAGTCCGTCTTGGGAAGAAGAATTCATCTTTGAGCTCAGTGCTAAATCCAGGGAGCTTCAGTTGCAGATTGTGGAAGCAGGGAAGTCCCCAGAGGGTGCCCCTCTAGCCTCAGCGAATGTGCCCTTGGATCTGTTCCATAAGCAGCCAACAGGGCGGCAGAGTTTCCCCCTGAGAAGCGTATCTGGCAAGGCTGTGTGTGGATCGGTCAGTGCGCAGTTCCTTTATATTGAACCAAGCGAGGGAAAATCCTGGACAATTCCGACACCAGTGGCTGCCAAAAAGGTAGAGAAGGATCGGACGGTGATGCCTTGTGGGACAGTGGTCACCACTGTGACATCGGTGATCTCAAGCCTCGGCTGGATGGGAAGAGCCCAACTCAGAGCAATGATTCCCCTGCAAAGACACCCCTAAAATCAGGGTGATAGGAAGGGAC
  5   1   2      skin In54                            IMAGE:8944527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGGCTGTGTGTGGATCGGTCAGTGCGCAGTTCCTTTATATTGAACCAAGCGAGGGAAAATCCTGGACAATTCCGACACCAGTGGCTGCCAAAAAGGTAGAGAAGGATCGGACGGTGATGCCTTGTGGGACAGTGGTCACCACTGTGACATCGGTGATCTCAAAGCCTCGGCTGGATGGGAAGAGCCCAACTCAGAGCAATGATTCCCCTGCAAAGACACCCCCTAAAATCAAGGTGATAGGAAGGGACTTCTCTGTGCAAGCAATGCCTTCTGAGAGCACTGTGGTCAGCAAAGCCTTGTCATCGTCCGACACAGAGCTTTTGTTTCTGAATGGCTCAGATCCCGTTGCAGAAGCTGCTATCCGCCAGCTCCGGGAATCCTCCAAACAGTCATTTAAGTCTCCAAGAAAGAAGAGCACCATTATTATATCAGGGATCTCCAAGACTGCCGTATCTCACGACGAAGAGGCATCACTTATGTTCAATTATGCCGAGGCCATGGACAACTCAGTTATGAACTCTCCCCATTCTGTGTATGAAAGTGCCACCCCCCACATCAGCTGCAGATATAGACCAGTTGGAGGTCTCTGTGCCAACCCTACCATCTCCAGTCTCAGAAGATGAGCTTCTTGGTACATGGGAGCAAGGCAGTGAGCTGGAGGAGTGGAATATCAATGGTTTGGAGGACCCAGACTGTGAAGAATGTCCATCAGCAACCTGAGCGTCTCTGAAACGGGAAGCATGAAGAAATCCAAGGTGGATTTTTAAAGAAAGGGCAAGCTCTTTTTCTATGAGCACAGCGAAGGAGCAGCATGATCAGTTCCAAAATGACTTCGTCTTACTGTGTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)