Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA043g13.5                          6 END     3          75       60                LOC494708 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012097019 Xt7.1-CAAO2203.3 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO2203.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTGGTACAGCAATACCAAATTGTGGATTGTCGATATCCATACGAATATGCTGGAGGGCACATTAAGGGAGCCTACAATTTATACAAAGAAGAGCATATCTCAGACACATTTCTGAAGAACGCCACTCATCCCAAAAGCACAACCCTCCTGATCTTCCACCGTGAATTCTCTTCAGAGAGAGCTCCAAAACTGTGCCGCTTACTAAGAAACTTGGACAGAAATGCAAACAGATATCCTCACCTGCACTATCCAGAACTCTATATTTTAAAGGGAGGATATAAGGAATTTCTATGAAAAATTTAAGGGTTTTCTGTGAACCACGGGGATATGTGAAAATATGTTACATAAGGACTTTAGCGATCAGCTAAGGCAATACCATCGGAAGAACAAAACATGCCACATTCGTACTGTCCGGAAAGAGCTGTTTAAGCCTCTGTATTCAAACAAATGTACTGTGTTAAAGAAAGATCCAGCAAAAGACTAGGCGGGAAATGATAAGAATCTTATAGGGGCAAGAGAGGCTAGTGCTACAGTGCTGTAAATGAAAGCTTACCTTAAAAATACATATCTTCCAGTTATAAAATATATAGTAAATAATGTACCCCCTTTTGTAAAATATAAGGATATTAAGTTACAGAGGAGTTCCATGACTATATAAAGGCACAAGGCTTAAGGCCAAGGGCTTTCATACAGGTCATGGCCCTCCGAGGTGACTTCTAATATCCTTATATTTTATAAGAGCAGAGAGAAGTGGATCATTATCTTCCTCATGACATGGGGTTGGTTGACAGCTCTGTAAGAGGTGGGGTACAAGTTTCATAAGTCATGTGAAAGAAATTACATAACTAAGCACCAATTATAACAGAAGCTGAAGGATTCATTTTTTTGCTGAAGTAAATAAAGAGAAAAACAAAGGACCAATAAATAATAATGGCAGGGAAAAGGTTCTGGAAGTTTCAACTAGAATAATGCCGGCAAAGAGAGACCCATAGTCCAGGGTATGAAAATCTCATTTTGCTAAATATAATTTACAGTTCTTTCAATTTTCGCCATTTACTGATCATAAGACTCTGTATGAATGAATGAATGCAGAACAAGGGATTCTTACCATAAAATATTTGAAATCACACAAACTGTAAATATGACTTCTCCTGTCTGAATGCCACCATTAATCATATAAATAATACCTTGGATCATAATTGAATATTTGTTAATGAGACTTAAAGGCACACAGGCCAGCAATAAAAGGAAAAACACAACAAAAAAAAAA
                                                  Xt7.1-CHK-1008247110                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACAGCAATACCAAATTGTGGATTGTCGATATCCATACGAATATGCTGGAGGGCACATTAAGGGAGCCTACAATTTATACAAAGAAGAGCATATCTCAGACACATTTCTGAAGAACGCCACTCATCCCAAAAGCACAACCCTCCTGATCTTCCACCGTGAATTCTCTTCAGAGAGAGCTCCAAAACTGTGCCGCTTACTAAGAAACTTGGACAGAAATGCAAACAGATATCCTCACCTGCACTATCCAGAACTCTATATTTTAAAGGGAGGATATAAGGAATTTCTATGAAAAATTTAAGGGTTTTCTGTGAACCACGGGGATATxTGxxAATATGTTACATAAGGACTTTAGCGATCAGCTAAGGCAATACCATCGGAAGAACAAAACATGCCACATTCGTACTGTCCGGAAAGAGCTGTTTAAGCCTCTGTATTCAAACAAATGTACTGTGTTAAAGAAAGATCCAGCAAAAGACTAGGCGGGAAATGATAAGAATCTTATAGGGGCAAGAGAGGCTAGTGCTACAGTGCTGTAAATGAAAGCTTACCTTAAAAATACATATCTTCCAGTTATAAAATATATAGTAAATAATGTACCCCCTTTTGTAAAATATAAGGATATTAAGTTACAGAGGAGTTCCATGACTATATAAAGGCACAAGGCTTAAGGCCAAGGGCTTTCATACAGGTCATGGCCCTCCGAGGTGACTTCTAATATCCTTATATTTTATAAGAGCAGAGAGAAGTGGATCATTATCTTCCTCATGACATGGGGTTGGTTGACAGCTCTGTAAGAGGTGGGGTACAAGTTTCATAAGTCATGTGAAAGAAATTACATAACTAAGCACCAATTATAACAGAAGCTGAAGGATTCATTTTTTTGCTGAAGTAAATAAAGAGAAAAACAAAGGACCAATAAATAATAATGGCAGGGAAAAGGTTCTGGAAGTTTCAACTAGAATAATGCCGGCAAAGAGAGACCCATAGTCCAGGGTATGAAAATCTCATTTTGCTAAATATAATTTACAGTTCTTTCAATTTTCGCCATTTACTGATCATAAGACTCTGTATGAATGAATGAATGCAGAACAAGGGATTCTTACCATAAAATATTTGAAATCACACAAACTGTAAATATGACTTCTCCTGTCTGAATGCCACCATTAATCATATAAATAATACCTTGGATCATAATTGAATATTTGTTAATGAGACTTAAAGGCACACAGGCCAGCAATAAAAGGAAAAACACAACAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                     PROTEIN --- Sc ---- 9e-018     NP_013750.1 Mitotic Inducer Homolog  S. pombe cdc25+ homolog; Mih1p [Saccharomycescerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 2e-019     NP_498972.1 cell Division Cycle related (36.5 kD) (cdc-25.3) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-023     XP_781555.2 PREDICTED: similar to Cdc25 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                                                                                PROTEIN --- Dm ---- 2e-027     NP_524547.1 string CG1395-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 3e-031     CAJ83049.1 cell division cycle 25A [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 2e-028     XP_682719.1 PREDICTED: cdc25 isoform 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-029     NP_963861.1 cell division cycle 25A isoform b; dual specificity phosphatase CDC25A; M-phaseinducer phosphatase 1 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 8e-032     XP_418479.2 PREDICTED: similar to Cell division cycle 25A [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 4e-030     NP_031684.3 cell division cycle 25 homolog A [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xl ---- 1e-050     AAH82713.1 LOC494708 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - ?? ---- 1e-050     NP_001088017.1 hypothetical protein LOC494708 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO2203.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA------TAA------------------------------------------TAA------TAG------------------------------------ATG------------------------------TAA------------------ATG------------------------------------------TGATAA------------------------TAG------------------------------TAA------------------------------------TAA---------------------TAA------TAA------------------------------------------------------------------ATG------------------TAA---------------TAA------------------------------------ATG------------------------------------------TAA---ATGTGA---------------TAA---------------------------------------------TAA------------------------TAA------ATG---------------------------------TAA---------------------------------------------------------------------------------------------------------ATG------TGAATG---------------------TAA------TGA------------------------------------------------------------------------------TGA------------------TAA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                             ...
  5   1   2       bld TbA                            TTbA038e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTGGTACAGCAATACCAAATTGTGGATTGTCGATATCCATACGAATATGCTGGAGGGCACATTAAGGGAGCCTACAATTTATACAAAGAAGAGCATATCTCAGACACATTTCTGAAGAACGCCACTCATCCCAAAAGCACAACCCTCCTGATCTTCCACCGTGAATTCTCTTCAGAGAGAGCTCCAAAACTGTGCCGCTTACTAAGAAACTTGGACAGAAATGCAAACAGATATCCTCACCTGCACTATCCAGAACTCTATATTTTAAAGGGAGGATATAAGGAATTTCTATGAAAAATTTAAGGGTTTTCTGTGAACCACGGGGATATGTGAATATGTTACATAAGGACTTTAGCGATCAGCTAAGGCAATACCATCGGAAGAACAAAACATGCCACATTTCGTACTGGTCCGGAAAGAGCTGTTTAAGCCTCTGTATTCAAACAAATGTACTGTGTTAAAGAAAGATCCAGCAAAAGACTAGGCGGGAAATGATAAGAATCTTATAGGGGCAAGAGAGGCTAGTGCTACAGTGGCTGTAAATGAAAGCTTACCTTAAAAATACATATCTTCCAGTTATAAAATATATAGTAAATAATGTACCCCCTCTTGTAAAATATAAGGAT
  3   1   2       bld Te5       out                         CAAO494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGAGGATATAAGGAATTCTATGAAAAATTTAAGGGTTTCTGTGAACCACGNGGATATGTGAATATGTTACATAAGGACTTTAGCGATCAGCTAAGGCAATACCATCGGAAGAACAAAACATGCCACATTCGTACTGTCCGGAAAGAGCTGTTTAAGCCTCTGTATTCAAACAAATGTACTGTGTTAAAGAAAGATCCAGCAAAAGACTAGGCGGGAAATGATAAGAATCTTATAGGGGCAAGAGAGGCTAGTGCTACAGTGCTGTAAATGAAAGCTTACCTTAAAAATACATATCTTCCAGTTATAAAATATATagtaaataatgtacccccttttgtaaaatataaggatattaagttacagaggagttccatgactgtataaaggcacaaggcttaaggccaagggctttcatacaggtcatggccctccgaggtgacttctaatatccttatattttataaGAGCAGAGAGAAGTGGATCATTATCTTCCTCATGACATGGGGTTGGTTGACAGCTCTGTAAGAGGTGGGGTacaagtttcataagtcatgtgaaagaaattacataactaagcaccaattataacAGAAGCTGAAGGATTCATTTTTTTGCTGAAGTAAAT
  3   1   2      seed Te5  5g3  out                        CAAO2203.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATATGTGAATATGTTACATAAGGACTTTAGCGATCAGCTAAGGCAATACCATCGGAAGAACAAAACATGCCACATTCGTACTGTCCGGAAAGAGCTGTTTAAGCCTCTGTATTCAAACAAATGTACTGTGTTAAAGAAAGATCCAGCAAAAGACTAGGCGGGAAATGATAAGAATCTTATAGGGGCAAGAGAGGCTAGTGCTACAGTGCTGTAAATGAAAGCTTACCTTAAAAATACATATCTTCCAGTTATAAAATATATagtaaataatgtacccccttttgtaaaatataaggatattaagttacagaggagttccatgactatataaaggcacaaggcttaaggccaagggctttcatacaggtcatggccctccgaggtgacttctaatatccttatattttataaGAGCAGAGAGAAGTGGATCATTATCTTCCTCATGACATGGGGTTGGTTGACAGCTCTGTAAGAGGTGGGGTacaagtttcataagtcatgtgaaagaaattacataactaagcaccaattataacAGAAGCTGAAGGATTCATTTTTTTGCTGAAGTAAATAAAGAGAAAAACAAAGGACCAATAAATAATAATGGCAGGGAAAAGGTTCTGGAAGTTTCAACTAGAATAATGCCGGCAAAGAGAGACCCATAGTCCAGGGTATGAAAATCTCATTTTGCTAAATATAATTTACAGTTCTTTCAATTTTCGCCATTTACTGATCATAAGACTCTGTATGAATGAATGAATGCAGAACAAGGGATTCTTACCATAAAATATTTGAAATCACACAAACTGT
  3   1   2      skin HdA  FL   out                   THdA043g13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAGAGAGAAGTGGATCATTATTTTCCTCATGACATGGGGTTGGTTGACAGCTCTGTAAGAGGTGGGGTacaagtttcataagtcatgtgaaagaaattacataactaagcaccaattataacAGAAGCTGAAGGATTCATTTTTTTGCTGAAGTAAATAAAGAGAAAAACAAAGGACCAATAAATAATAATGGCAGGGAAAAGGTTCTGGAAGTTTCAACTAGAATAATGCCGGCAAAGAGAGACCCATAGTCCAGGGTATGAAAATCTCATTTTGCTAAATATAATTTACAGTTCTTTCAATTTTCGCCATTTACTGATCATAAGACTCTGTATGAATGAATGAATGCAGAACAAGGGATTCTTACCATAAAATATTTGAAATCACACAAACTGTAAATATGACTTCTCCTGTCTGAATGCCACCATTAATCATATAAATAATACCTTGGATCATAATTGAATATTTGTTAATGAGACTTAAAGGCACACAGGCCAGCAATAAAAGGAAAAACACAACAAAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)