Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 198.0    0Xt7.1-CBWN2428.3                            3 PI      100       672      775                hypothetical protein FLJ32800 [Homo sapiens]

 This cluster: approximate FL confidence score = 96%

 1012097157 Xt7.1-CABJ8621.5 - 5 ESTs
                                                                       -140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ8621.5                                                                                                                                             TGAGTTGAGAAATAGTTTGTCGCTACAGAATCTCATGTTGCAAAGAGCAGGCAGGAGAAATGGAATACGTGTATATTCAGCTGTTATCTGCAGGAACAATTCTGTTACTTTTGCATCTAACAGCGAGTCCGTGCAGTCCTGAACACTACAACTGCCGATGTCACAATATCCTGATACTCTGAAGGGAACTGTGTTGAGAAACAGTTGAGAAGTCCAGGTTTTATGGCTTACACAGAAGACAAGAATACAAGCCTGGAAGTGTCTTGAGTCAGGAATTTGCATCAACAGCACAGACTTCATTCAGGTCCTGGACCTAGAAACACTAATCCATCTGAGATTTACGTTTCATTATGATGTCCATGAACACCCAGAGCAGTGCACTATAATGCGCAAATGGATGCTAACTTGGATCCTTCCAACTTTGCTCTACAGACCATATCTTCACATAATATTCATTCTGGGCACTGTGTCTCTAGCCTGCAATGACATGACTCCAGAGCAAATGGCTATAAACGTGAATTGCTCCAGCCCAGAAAGACATACCAGAAGTTATGATTATATGGAGGGAGGGGATGTAAGAATAAGGAAACTTTTTTGTCGAACGCAATGGTATCTGTGGATTGATAAAAGAGGCAATGTGAAGGGAACACAGGACCCAAACAACAGCTTCAGTATCTTGGAAATTAGAACAGTGGCAGTCGGAATCGTGGCAATAAAATGCATTGAAAGTGAATATTTTTTAGCTATGAACAAATCTGGAAGACTTTACGGAAAGAAATCATGCAATGAAGACTGCAATTTTAGAGAATTAATCCAAGAGAACAAATATAACACATATGCATCAGCAAAGTGGACAAATAATGGGAAAGAAATGTTTGTTGCCTTGAACAGCAAAGGTTCACCAATGAAAGGAAAGAAATCCAAGAAGGAACACAAAGGATCCCACTTCCTTCCGCTGTCAACATCCTAACCATAACCCTGATACTGGTTCCAGCAGATTATTTTTATTTTATTAATATTAATAATAATGCTAATAATAAAAAGTGGAAAAGGACACAAATATAAGCTGGATCTACTACTGAAACAAACAAGCTGGACTTGCGCATTTCAAAAGAC
                                                  Xt7.1-CHK-1008242510                                                                                                                                                   GAGAAATAGTTTGTCGCTACAGAATCTCATGTTGCAAAGAGCAGGCAGGAGAAATGGAATACGTGTATATTCAGCTGTTATCTGCAGGAACAATTCTGTTACTTTTGCATCTAACAGCGAGTCCGTGCAGTCCTGAACACTACAACTGCCGATGTCACAATATCCTGATACTCTGAAGGGAACTGTGTTGAGAAACAGTTGAGAAGTCCAGGTTTTATGGCTTACACAGAAGACAAGAATACAAGCCTGGAAGTGTCTTGAGTCAGGAATTTGCATCAACAGCACAGACTTCATTCAGGTCCTGGACCTAGAAACACTAATCCATCTGAGATTTACGTTTCATTATGATGTCCATGAACACCCAGAGCAGTGCACTATAATGCGCAAATGGATGCTAACTTGGATCCTTCCAACTTTGCTCTACAGACCATATCTTCACATAATATTCATTCTGGGCACTGTGTCTCTAGCCTGCAATGACATGACTCCAGAGCAAATGGCTATAAACGTGAATTGCTCCAGCCCAGAAAGACATACCAGAAGTTATGATTATATGGAGGGAGGGGATGTAAGAATAAGGAAACTTTTTTGTCGAACGCAATGGTATCTGTGGATTGATAAAAGAGGCAATGTGAAGGGAACACAGGACCCAAACAACAGCTTCAGTATCTTGGAAATTAGAACAGTGGCAGTCGGAATCGTGGCAATAAAATGCATTGAAAGTGAATATTTTTTAGCTATGAACAAATCTGGAAGACTTTACGGAAAGAAATCATGCAATGAAGACTGCAATTTTAGAGAATTAATCCAAGAGAACAAATATAACACATATGCATCAGCAAAGTGGACAAATAATGGGAAAGAAATGTTTGTTGCCTTGAACAGCAAAGGTTCACCAATGAAAGGAAAGAAATCCAAGAAGGAACACAAAGGATCCCACTTCCTTCCGCTGTCAACATCCTAACCATAACCCTGATACTGGTTCCAGCAGATTATTTTTATTTTATTAATATTAATAATAATGCTAATAATAAAAAGTGGAAAAGGACACAAATATAAGCTGGATCTACTACTGAAACAAACAAGCTGGACTTGCGCATTTCAAAAGACTGTGGT
                                                      consensus depths                                                                                                                                                  2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     2     3     2     3     2     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     385     561                                                                                                                                             
                                               BLH MIN     385      78                                                                                                                                             
                                               BLH OVR     385     997                                                                                                                                             
                                               ORF LNG     385      26                                                                                                                                             
                                                                       PROTEIN --- Dm ---- 3e-012     NP_732452.1 CG4608-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PREDICTED - Sp ---- 1e-012     XP_787124.2 PREDICTED: similar to fibroblast growth factor [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 7e-018     NP_498403.1 Lethal-756, essential fibroblast growth factor, human 20-like (49.6 kD)(let-756) [Caenorhabditis elegans] -------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Cs ---- 2e-019     BAB88673.1 fibroblast growth factor 9/16/20 [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 3e-021     BAC22069.1 fibroblast growth factor 9/16/20 [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 4e-050     NP_001007762.1 fibroblast growth factor 7 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 2e-085     NP_032034.1 fibroblast growth factor 7; Keratinocyte growth factor [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 4e-088     NP_002000.1 fibroblast growth factor 7 precursor; keratinocyte growth factor [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 7e-094     NP_001012543.1 fibroblast growth factor 7 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 1e-108     AAH99341.1 MGC116536 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 1e-108     NP_001089637.1 hypothetical protein LOC734697 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 9e-114     CAJ82434.1 fibroblast growth factor 7 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ8621.5                                                                                                                                                                               ATG------------------------------------------------------------------------------------------------------TGA---------------ATG---------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------TAA---TAA---TGA---------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  0   1   1           Neu  FL                     TNeu035m16.FL-Sanger    CTTGTTCGTGCATTCAGCTGCTGAGCGGTTAATTGCTTCCAAGTGAGGTCAGCAAAAGGTATTTATCGAAAACCATTGAACAACAACAGGCTCAACACACACAGAAAACCCCTCTTGCGTGTTGATTTATGGAAACAATTAGGATTGTGCTGGAGTTTTTCTGAGTTGAGAAATAGTTTGTCGCTACAGAATCTCATGTTGCAAAGAGCAGGCAGGAGAAATGGAATACGTGTATATTCAGCTGTTATCTGCAGGAACAACGAGTCCGTGCAGTCCTGAACACTACAACTGCCGATGTCACAATATCCTGATACTCTGAAGGGAACTGTGTTGAGAAACAGTTGAGAAGTCCAGGTTTTATGGCTTACACAGAAGACAAGAATACAAGCCTGGAAGTGTCTTGAGTCAGGAATTTGCATCAACAGCACAGACTTCATTCAGGTCCTGGACCTAGAAACACTAATCCATCTGAGATTTACGTTTCATTATGATGTCCATGAACACCCAGAGTAGTGCACTATAATGCGCAAATGGATGCTAACTTGGATCCTTCCAACTTTGCTCTACAGACCATATCTTCACATAATATTCATTCTGGGCACTGTGTCTCTAGCCTGCAATGACATGACTCCAGAGCAAATGGCTATAAACGTGAATTGCTCCAGCCCAGAAAGACATACCAGAAGTTATGATTATATGGAGGGAGGGGATGTAAGAATAAGGAAACTTTTTTGTCGAACGCAATGGTATCTGTGGATTGATAAAAGAGGCAATGTGAAGGGAACACAGGACCCAAACAACAGCTTCAGTATCTTGGAAATTAGAACAGTGGCAGTCGGAATCGTGGCAATAAAATGCATTGAAAGTGAATATTTTTTAGCTATGAACAAATCTGGAAGACTTTACGGAAAGAAATCATGCAATGAAGACTGCAATTTTAGAGAATTAATCCAAGAGAACAAATATAACACATATGCATCAGCAAAGTGGACAAATAATGGGAAAGAAATGTTTGTTGCCTTGAACAGCAAAGGTTCACCAATGAAAGGAAAGAAATCCAAGAAGGAACACAAAGGATCCCACTTCCTTCCGCTGTCAACATCCTAACCATAACCCTGATACTGGTTCCAGCAGATTATTTTTATTTTATTAATATTAATAATAATGCTAATAATAAAAAGTGGAAAAGGACACAAATATAAGCTGGATCTACTACTGAAACAAACAAGCTGGACTTGCGCATTTCAAAAGACTGTGGTCAAAAAAAAAAAAAAAAAA
  5   1   1           Tbd0 FL                     IMAGE:6980824.FL-MGC                                             TCGAAAACCATTGAACAACAACAGGCTCAACACACACAGAAAACCCCTCTTGCGTGTTGATTTATGGAAACAATTAGGATTGTGCTGGAGTTTTTCTGAGTTGAGAAATAGTTTGTCGCTACAGAATCTCATGTTGCAAAGAGCAGGCAGGAGAAATGGAATACGTGTATATTCAGCTGTTATCTGCAGGAACAATTCTGTTACTTTTGCATCTAACAGCGAGTCCGTGCAGTCCTGAACACTACAACTGCCGATGTCACAATATCCTGATACTCTGAAGGGAACTGTGTTGAGAAACAGTTGAGAAGTCCAGGTTTTATGGCTTACACAGAAGACAAGAATACAAGCCTGGAAGTGTCTTGAGTCAGGAATTTGCATCAACAGCACAGACTTCATTCAGGTCCTGGACCTAGAAACACTAATCCATCTGAGATTTACGTTTCATTATGATGTCCATGAACACCCAGAGCAGTGCACTATAATGCGCAAATGGATGCTAACTTGGATCCTTCCAACTTTGCTCTACAGACCATATCTTCACATAATATTCATTCTGGGCACTGTGTCTCTAGCCTGCAATGACATGACTCCAGAGCAAATGGCTATAAACGTGAATTGCTCCAGCCCAGAAAGACATACCAGAAGTTATGATTATATGGAGGGAGGGGATGTAAGAATAAGGAAACTTTTTTGTCGAACGCAATGGTATCTGTGGATTGATAAAAGAGGCAATGTGAAGGGAACACAGGACCCAAACAACAGCTTCAGTATCTTGGAAATTAGAACAGTGGCAGTCGGAATCGTGGCAATAAAATGCATTGAAAGTGAATATTTTTTAGCTATGAACAAATCTGGAAGACTTTACGGAAAGAAATCATGCAATGAAGACTGCAATTTTAGAGAATTAATCCAAGAGAACAAATATAACACATATGCATCAGCAAAGTGGACAAATAATGGGAAAGAAATGTTTGTTGCCTTGAACAGCAAAGGTTCACCAATGAAAGGAAAGAAATCCAAGAAGGAACACAAAGGATCCCACTTCCTTCCGCTGTCAACATCCTAACCATAACCCTGATACTGGTTCCAGCAGATTATTTTTATTTTATTAATATTAATAATAATGCTAATAATAAAAAGTGGAAAAGGACACAAATATAAGCTGGATCTACTACTGAAACAAACAAGCTGGACTTGCGCATTTCAAAAGACTGTGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu  FL                        TNeu035m16.p1kSP6   CTTGTTCGTGCATTCAGCTGCTGAGCGGTTAATTGCTTCCAAGTGAGGTCAGCAAAAGGTATTTANTCGAAAACCATTGAACAACAACAGGCTCAACACACACAGAAAACCCCTCTTGCGTGTTGATTTATGGAAACAATTAGGATTGTGCTGGAGTTTTTCTGAGTTGAGAAATAGTTTGTCGCTACAGAATCTCATGTTGCAAAGAGCAGGCAGGAGAAATGGAATACGTGTATATTCAGCTGTTATCTGCAGGAACAACGAGTCCGTGCAGTCCTGAACACTACAACTGCCGATGTCACAATATCCTGATACTCTGAAGGGAACTGTGTTGAGAAACAGTTGAGAAGTCCAGGTTTTATGGCTTACACAGAAGACAAGAATACAAGCCTGGAAGTGTCTTGAGTCAGGAATTTGCATCAACAGCACAGACTTCATTCAGGTCCTGGACCTAGAAACACTAATCCATCTGAGATTTACGTTTCATTATGATGTCCATGAACACCCAGAGTAGTGCACTATAATGCGCAAATGGATGCTAACTTGGATCCTTCCAACTTTGCTCTACAGACCATATCTTCACATAATATTCATTCTGGGCACTGTGTCTCTAGCCTGCAATGACATGACTCCAGAGCAAATGGCTATAAACGTGAATTGCT
  5   1   2       bld Tbd0 FL                            IMAGE:6980824                                             TCGAAACCATTGAACAACAACAGGGCTCAACACACACAGAAAACCCCTCTTGCGTGTTGATTTATGGAAACAATTAGGATTGTGCTGGAGTTTTTCTGAGTTGAGAAATAGTTTGTCGCTACAGAATCTCATGTTGCAAAGAGCAGGCAGGAGAAATGGAATACGTGTATATTCAGCTGTTATCTGCAGGAACAATTCTGTTACTTTTGCATCTAACAGCGAGTCCGTGCAGTCCTGAACACTACAACTGCCGATGTCACAATATCCTGATACTCTGAAGGGAACTGTGTTGAGAAACAGTTGAGAAGTCCAGGTTTTATGGCTTACACAGAAGACAAGAATACAAGCCTGGAAGTGTCTTGAGTCAGGAATTTGCATCAACAGCACAGACTTCATTCAGGTCCTGGACCTAGAAACACTAATCCATCTGAGATTTACGTTTCATTATGATGTCCATGAACACCCAGAGCAGTGCACTATAATGCGCAAATGGATGCTAACTTGGATCCTTCCAACTTTGCTCTACAGACCATATCTTCACATAATATTCATTCTGGGCACTGTGTCTCTAGCCTGCAATGACATGACTCCAGAGCAAATGGCTATAAACGTGAATTGCTCCAGCCCAGAAAGACATACCAGAAGTTATGATTATATGGAGGGAGGGGATGTAAGAATAAGGAACTTTTTTGTCGAACGCAATGGTATCTGTGGATTATAANNAGGGCAATGTGAAGGGACACNNAGACCAACACAGCTCAGTATCTGGAATTAAACAGTGCAGTCGGATCGG
  5   1   2   10 seed Ski1 5g3  in                         CABJ8621.5p .......................................................................................................................................TTTTCTGAGTTGAGAAATAGTTTGTCGCTACAGAATCTCATGTTGCAAAGAGCAGGCAGGAGAAATGGAATACGTGTATATTCAGCTGTTATCTGCAGGAACAATTCTGTTACTTTTGCATCTAACAGCGAGTCCGTGCAGTCCTGAACACTACAACTGCCGATGTCACAATATCCTGATACTCTGAAGGGAACTGTGTTGAGAAACAGTTGAGAAGTCCAGGTTTTATGGCTTACACAGAAGACAAGAATACAAGCCTGGAAGTGTCTTGAGTCAGGAATTTGCATCAACAGCACAGACTTCATTCAGGTCCTGGACCTAGAAACACTAATCCATCTGAGATTTACGTTTCATTATGATGTCCATGAACACCCAGAGCAGTGCACTATAATGCGCAAATGGATGCTAACTTGGATCCTTCCAACTTTGCTCTACAGACCATATCTTCACATAATATTCATTCTGGGCACTGTGTCTCTAGCCTGCAATGACATGACTCCAGAGCAAATGGCTATAAACGTGAATTGCTCCAGCCCAGAAAGACATACCAGAAGTTATGATTATATGGAGGGAGGGGATGTAAGAATAAGGAAACTTTTTTGTCGAACGCAATGGTATCTGTGGATTGATAAAAGAGGCAATGTGAAGGGAACACAGGACCCAAACAACAGCTTCAGTATCTTGGAAATTAGAACAGTGGCAGTCGGAATCGTGGCAATAAAATGCATTGAAAGTGAATATTTTTTAGCTATGAACAAATCTGGAAGACTTTACGGAAAGAAATCATGCAATGAAGACTGCAATTTTAGAGAATTAATCCAAGAGAACAAATATNACACATATGCATCAGCAAAGTGGACAAATAATGGGAAAGAAA
  3   1   2      shim Neu                             TNeu059c04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAATGACATGACTCCAGAGCAAATGGCTATAAACGTGAATTGCTCCAGCCCAGAAAGACATACCAGAANGTTATGATTATATGGAGGGAGGGGATGTAAGAATAAGGAAACTTTTTTGTCGAACGCAATGGTATCTGTGGATTGATAAAAGAGGCAATGTGAAGGGAACACAGGACCCAAACAACAGCTTCAGTATCTTGGAAATTAGAACAGTGGCAGTCGGAATCGTGGCAATAAAATGCATTGAAAGTGAATATTTTTTAGCTATGAACAAATCTGGAAGACTTTACGGAAAGAAATCATGCAATGAAGACTGCAATTTTAGAGAATTAATCCAAGAGAACAAATATAACACATATGCATCAGCAAAGTGGACAAATAATGGGAAAGAAATGTTTGTTGCCTTGAACAGCAAAGGTTCACCAATGAAAGGAAAGAAATCCAAGAAGGAACACAAAGGATCCCACTTCCTTCCGCTGTCAACATCCTAACCATAACCCTGATACTGGTTCCAGCAGATTATTTTTATTTTATTAATATTAATAATAATGCTAATAATAAAAAGTGGAAAAGGACACAAATATAAGCTGGATCTACTACTGAAACAAACAAGCTGGACTTGCGCATTTCAAAAGACTGTGGTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1 5g3  in                         CABJ8621.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTATGAACAAATCTGGAAGACTTTACGGAAAGAAATCATGCAATGAAGACTGCAATTTTAGAGAATTAATCCAAGAGAACAAATATAACACATATGCATCAGCAAAGTGGACAAATAATGGGAAAGAAATGTTTGTTGCCTTGAACAGCAAAGGTTCACCAATGAAAGGAAAGAAATCCAAGAAGGAACACAAAGGATCCCACTTCCTTCCGCTGTCAACATCCTAACCATAACCCTGATACTGGTTCCAGCAGATTATTTTTATTTTATTAATATTAATAATAATGCTAATAATAAAAAGTGGAAAAGGACACAAATATAAGCTGGATCTACTACTGAAACAAACAAGCTGGACTTGCGCATTTCAAAAGACTGTGGTCAAAAAAAGAGAGAAAAAGAATCAAAAACCAAAAAAGTTATCCAAAGAATGATAATAAGTACAGGTTGTAAAAAGTCTGAAGAGTTGTACAAATATATCTCAGTAATAATCCAGGGGTATTATTTTTGTTAAATTATATAACCCCAAAGAAGGAGGGTTGACTTGAATATCTGATGATTAATACTAAAATAAAATTAAAAATCTGCTTGTCAATTAAGGCTGCTATATTTTTTCCTAGAGCAGATAATAGTGTTAGCTAAACATGTTGGAGTTTGAGGCTGCTGGAATGAGGTCAGATCTTCAAGTCAATCCTGCATGTAGACATTGAATGGTACATTAAGAAAACCCTTATTGAAGAAACTGTATGCGCACTATAATAAAAAAAAACAATATTTTTTTTACGTTTGTGACTATGGCATTCAAATAAAAAATGTATTTATGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)