Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAR5065.5                            3 END     1          33       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 935.0    0Xt7.1-CABD8275.5.5                        171 PI      86          5      810                Unknown (protein for IMAGE:7025352) [Xenopus tropicalis]
     31082.0    0Xt7.1-CABD11070.5                          26 PI      86         16      935                Unknown (protein for IMAGE:7004347) [Xenopus tropicalis]
     41158.0    0Xt7.1-CABD12544.3                          12 PI      88          8      905                LOC496676 protein [Xenopus tropicalis]
     5 625.0    0Xt7.1-CBST8256.5                            3 PI      88        409      900                Unknown (protein for IMAGE:7025444) [Xenopus tropicalis]
     61166.0    0Xt7.1-CAAR12939.5                           2 PI      89         38      907                Unknown (protein for IMAGE:7004347) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 54%

 1012097447 Xt7.1-CAAQ10843.5 - 3 ESTs
                                                                       ....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAQ10843.5                                   CAAACAACATGGACACTGACTTCACAGGCAAAGATGTTTATGAGAAGGAATTTGATCCTTGGAGTTATTTAGATACATATTATAACCCAATATCAGGCCTTGTGACGAAGGATGGTAATCTGGATTTTGCGTTAAAAAAACTTCATGAGGCATTTACCATGCATGGAGTGAAGGGGGAAACACTTATTGACGTTGGCCATGGACCAACAATTTATCAGGAACTTTCTGCATGCGAATCCTTCAGAGAGATCATTGGTGCTGAATACACTGACCGTAACCGCGAGTACTATGAAAAAACCCTGAGAAATGAACCAGGAATATTTGACTGGACAAGTGTTATACAAGCAGTCTGTGACCTGGAGGGAAAGGGTACAACAGTGGAAGAGAAGAGAGAAAAACTGAAAAAGACAGTGAAAAAGACTATCAAATGTGATGTAACTAAAAGCAATCCTGTGGCACCGCTGGTGTTGCCCAAAGCTGACTGTGTAATGGCTATTGGGTGTCTGGAATCTGCCTGTGAAGATCTGGATAGTTATTGTAATGCCCTTAATAATATTTCATCCTTGCTAAAAGTGGGGGGGTATTTAATAATCTCCGAAGTCCTTAACTGTACCACTTACTTGTTTGGAGACAAAAGGTTTTCTTGCTTATCGTTAAATGAGGAATTTATGAGAAGTGCTATAACCAATACCGGTTATGCTATAATAGACCTGGAGGTTTTTCCCAGAAAGTATGATGAAGAGCAGTACAATCTCTGTGATTATGACTCTAATATATTTGTTCTTGCACGCAAACTGAGGGATATTTAGGCTGGAGAGGACAGTACATAGTATATGACTGCTTATGTCTATTCTCTACCAAGATTTCTTTACACCTTCAGTTATAAAAAATATACCTATTCTGAACTAAAAAAAGAATCATTACTGCTCTATTTAAATTTCTCTATGGGGCTGATTCAAGAATGCTCAAAGCTTGCACATTCTTAAATTGGTCCCTTTGCCATTGTCACCTAAAGGAGTAAACATTTTTTTCTGCCCCTAAATAGCAATAGATCTATAAATTTAAATGGTTACACCCTTTTTAGGAGGAACAGAGGGAATGGAAAAGGTGGAGGGGCTTGTCTGTATATAAAGCCAGAATTAAAGCCTTGCACTAAAGATATTAACAGGGACAGCATGTACTCTTTATGTTTCCTATAAATTAAAATTCAAAACACTTTATGGACCAATACTATTATTGGACATTCTACAATAGTGACAAAAGAAGGTTCCTAACTTATTTAAACTCTAGACTTGTCTCATTACAATAATCATATATGGTATAGACACAGTGCCATCTATGTAGAAAACCCCCCAGATGTACTAAGATATTTGAAAAAAAAGCTAAAAATGTCTACAGCCCTGCCAAGATTTGAAGGGGTCAAATCAGACAGGTAAGGTCCCGACTGAAATTCAAACCATAAGGCAATACACAATT
                                                  Xt7.1-CHK-1008250765                                         ACATGGACACTGACTTCACAGGCAAAGATGTTTATGAGAAGGAATTTGATCCTTGGAGTTATTTAGATACATATTATAACCCAATATCAGGCCTTGTGACGAAGGATGGTAATCTGGATTTTGCGTTAAAAAAACTTCATGAGGCATTTACCATGCATGGAGTGAAGGGGGAAACACTTATTGACGTTGGCCATGGACCAACAATTTATCAGGAACTTTCTGCATGCGAATCCTTCAGAGAGATCATTGGTGCTGAATACACTGACCGTAACCGCGAGTACTATGAAAAAACCCTGAGAAATGAACCAGGAATATTTGACTGGACAAGTGTTATACAAGCAGTCTGTGACCTGGAGGGAAAGGGTACAACAGTGGAAGAGAAGAGAGAAAAACTGAAAAAGACAGTGAAAAAGACTATCAAATGTGATGTAACTAAAAGCAATCCTGTGGCACCGCTGGTGTTGCCCAAAGCTGACTGTGTAATGGCTATTGGGTGTCTGGAATCTGCCTGTGAAGATCTGGATAGTTATTGTAATGCCCTTAATAATATTTCATCCTTGCTAAAAGTGGGGGGGTATTTAATAATCTCCGAAGTCCTTAACTGTACCACTTACTTGTTTGGAGACAAAAGGTTTTCTTGCTTATCGTTAAATGAGGAATTTATGAGAAGTGCTATAACCAATACCGGTTATGCTATAATAGACCTGGAGGTTTTTCCCAGAAAGTATGATGAAGAGCAGTACAATCTCTGTGATTATGACTCTAATATATTTGTTCTTGCACGCAAACTGAGGGATATTTAGGCTGGAGAGGACAGTACATAGTATATGACTGCTTATGTCTATTCTCTACCAAGATTTCTTTACACCTTCAGTTATAAAAAATATACCTATTCTGAACTAAAAAAAGAATCATTACTGCTCTATTTAAATTTCTCTATGGGGCTGATTCAAGAATGCTCAAAGCTTGCACATTCTTAAATTGGTCCCTTTGCCATTGTCACCTAAAGGAGTAAACATTTTTTTCTGCCCCTAAATAGCAATAGATCTATAAATTTAAATGGTTACACCCTTTTTAGGAGGAACAGAGGGAATGGAAAAGGTGGAGGGGCTTGTCTGTATATAAAGCCAGAATTAAAGCCTTGCACTAAAGATATTAACAGGGACAGCATGTACTCTTTATGTTTCCTATAAATTAAAATTCAAAACACTTTATGGACCAATACTATTATTGGACATTCTACAATAGTGACAAAAGAAGGTTCCTAACTTATTTAAACTCTAGACTTGTCTCATTACAATAATCATATATGGTATAGACACAGTGCCATCTATGTAGAAAACCCCCCAGATGTACTAAGATATTTGAAAAAAAAGCTAAAAATGTCTACAGCCCTGCCAAGATTTGAAGGGGTCAAATCAGACAGGTAAGGTCCCGACTGAAATTCAAACCATAAGGCAATAC
                                                      consensus depths                                        1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG       8      88                                   
                                                                                                                                      PREDICTED - Gg ---- 9e-017     XP_001236304.1 PREDICTED: similar to Phenylethanolamine N-methyltransferase (PNMTase) (Noradrenaline N-methyltransferase) [Gallus gallus] =============================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 5e-021     NP_498334.1 phenylethanolamine n-methyltransferase family member (30.9 kD) (3H244)[Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PREDICTED - Dr ==== 1e-041     NP_956653.1 hypothetical protein MGC64002 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN === Mm ==== 4e-059     NP_035054.1 nicotinamide N-methyltransferase [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN === Hs ==== 2e-061     NP_006160.1 nicotinamide N-methyltransferase [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PREDICTED = Xl ==== 1e-121     AAH53814.1 Unknown (protein for MGC:64498) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PREDICTED = ?? ==== 1e-121     NP_001079743.1 hypothetical protein LOC379432 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN === Xt ==== 1e-147     AAH91098.1 Unknown (protein for IMAGE:7025444) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAQ10843.5                                           ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TAG------------------TAG---ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------TAA------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAA------------------------------------------------------------------------TAA------TAA---------------------------------------------------------------------------------------------------------ATG------------------------------------------TAA---------TGA
                                                                   ORF                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2   30  bld Te1  PIPE out                        CBWN9635.b1 ..................................CAAACAACATGGACACTGACTTCACAGGCAAAGATGTTTATGAGAAGGAATTTGATCCTTGGAGTTATTTAGATACATATTATAACCCAATATCAGGCCTTGTGACGAAGGATGGTAATCTGGATTTTGCGTTAAAAAAACTTCATGAGGCATTTACCATGCATGGAGTGAAGGGGGAAACACTTATTGACGTTGGCCATGGACCAACAATTTATCAGGAACTTTCTGCATGCGAATCCTTCAGAGAGATCATTGGTGCTGAATACACTGACCGTAACCGCGAGTACTATGAAAAAACCCTGAGAAATGAACCAGGAATATTTGACTGGACAAGTGTTATACAAGCAGTCTGTGACCTGGAGGGAAAGGGTACAACAGTGGAAGAGAAGAGAGAAAAACTGAAAAAGACAGTGAAAAAGACTATCAAATGTGATGTAACTAAAAGCAATCCTGTGGCACCGCTGGTGTTGCCCAAAGCTGACTGTGTAATGGCTATTGGGTGTCTGGAATCTGCCTGTGAAGATCTGGATAGTTATTGTAATGCCCTTAATAATATTTCATCCTTGCTAAAAGTGGGGGGGTATTTAATAATCTCCGAAGTCCTTAACTGTACCACTTACTTGTTTGGAGACAA
  5   1   2      seed Hrt1      out                       CAAQ10843.5p                                                         CACAGGCAAAGATGTTTATGAGAAGGAATTTGATCCTTGGAGTTATTTAGATACATATTATAACCCAATATCAGGCCTTGTGACGAAGGATGGTAATCTGGATTTTGCGTTAAAAAAACTTCATGAGGCATTTACCATGCATGGAGTGAAGGGGGAAACACTTATTGACGTTGGCCATGGACCAACAATTTATCAGGACCTTTCTGCATGCGAATCCTTCAGAGAGATCATTGGTGCTGAATACACTGACCGTAACCGCGAGTACTATGAAAAAACCCTGAGAAATGAACCAGGAATATTTGACTGGACAAGTGTTATACAAGCAGTCTGTGACCTGGAGGGAAAGGGTACAACAGTGGAAGAGAAGAGAGAAAAACTGAAAAAGACAGTGAAAAAGACTATCAAATGTGATGTAACTAAAAGCAATCCTGTGGCACCGCTGGTGTTGCCCAAAGCTGACTGTGTAATGGCTATTGGGTGTCTGGAATCTGCCTGTGAAGATCTGGATAGTTATTGTAATGCCCTTAATAATATTTCATCCTTGCTAAAAGTGGGGGGGTATTTAATAATCTCCGAAGTCCTTAACTGTACCACTTACTTGTTTGGAGACAAAAGGTTTTCTTGCTTATCGTTAAATGAGGAATTTATGAGAAGTGCTATAACCAATACCGGTTATGCTATAATAGACCTGGAGGTTTTTCCCAGAAAGTATGATGAAGAGCAGTACAATCTCTGTGATTATGACTCTAATATATTTGTTCTTGCACGCAAACTGAGGGATATTTAGGCTGGAGAGGACAGTACATAGTATATGACTGCTTATGTCTATTCTCTACCAAGATTTCTTTACACCTTCAGTTATAAAAAATATACCTATTCTGAACT
  5   1   2      skin Liv1      ?                         CAAR10444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAACTGTACCACTTACTTGTTTGGAGACAAAAGGTTTTCTTGCTTATCGTTAAATGAGGAATTTATGAGAAGTGCTATAACCAATACCGGTTATGCTATAATAGACCTGGAGGTTTTTCCCAGAAAGTATGATGAAGAGCAGTACAATCTCTGTGATTATGACTCTAATATATTTGTTCTTGCACGCAAACTGAGGGATATTTAGGCTGGAGAGGACAGTACATAGTATATGACTGCTTATGTCTATTCTCTACCAAGATTTCTTTACACCTTCAGTTATAAAAAATATACCTATTCTGAACTAAAAAAAGAATCATTACTGCTCTATTTAAATTTCTCTATGGGGCTGATTCAAGAATGCTCAAAGCTTGCACATTCTTAAATTGGTCCCTTTGCCATTGTCACCTAAAGGAGTAAACATTTTTTTCTGCCCCTAAATAGCAATAGATCTATAaatttaaatggttacaccctttttaggaggaacagagggaatggaaaaggtggaggggcttgtctgtatataaagccagaattaaagccttgcactaaagatattaACAGGGACAGCATGTACTCTTTATGTTTCCTATAAATTAAAATTCAAAACACTTTATGGACCAATACTATTATTGGACATTCTACAATAGTGACAAAAGAAGGTTCCTAACTTATTTAAACTCTAGACTTGTCTCATTACAATAATCATATATGGTATAGACACAGTGCCATCTATGTAGAAAACCCCCCAGATGTACTAAGATATTTGAAAAAAAAGCTAAAAATGTCTACAGCCCTGCCAAGATTTGAAGGGGTCAAATCAGACAGGTAAGGTCCCGACTGAAATTCAAACCATAAGGCAATACACAATTCTATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)