Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAK10146.3                          10 END     3          75       30                Unknown (protein for IMAGE:7662234) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 90%

 1012097536 Xt7.1-CAAK11769.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAK11769.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCATTGGAGCTTGGAGCAGCATAGCGGCCGGACCAGCCCAGGACTGCGGAGCTCATGGATCGCTACCGCTGGGGAAACGCTGCCGCCCCATTCAGCTCGGTGCCGCTACTCGCTATAGGAGCCATTACTGGCGCTGTCCGCGTCCCAAGTGCTGAAACCGAGCCAGCCGCGGCTTAGCGCCCCCTCCCTCCCCTCACAGCAGCTGAAGCGGACGGAGCAGCACACGGGATAAGCAGGCTACATGGTGGCAGCAGGAAGCGGGGTACAGCCATGGATTTATTGGGGAGACAGTCGCCCGGATCCCGCCCAGCACTGAGCGCTGCGCACAGATGGTAACACGCCGCAGTTTGGTAGATGTGGGATTATATACAAAAGGATGTGAGATAGATCCATGCTGGCTGGGGAGGGGTCGGGGGAGCGATTTTATCTGCTACAATGTCTGGTACCCGGGGTTGTACGGTGCTGCGGGCCCTCCGGTTGCTGCTGGTATTATCGGGCTGGGCGGCGGGGCAGCGGAGATACTCAGTAAGGGAGGAGCTCAGTCATGGGGCGTTTGTGGGCAACGTGGTGAGCGACCTGGGCTTGGATCTCAGGCTCCTACCCTCCCGGGGCTTTCGGATCGCGTCCGGTAACAGCAAACAGTATTTCGATGTGAATATCGGTAACGGGGTTTTATTTGTAAACCGAACCATAGACCGGGAAACTCTGTGCGACCCCGGCCCCCCCTGTCTCATCAACCTGGAGGTGGTTGTGGGGAACCCAGTGGAGGTGCACAACATCGAAGTAGAGATATTAGACATTAACGACAATGCTCCCAAATTCCCTAGAAATGAATATTATTTGGAGATCAGCGAGTCTGCCGTCCCTGGGGCCCGGTTTCCTATAGAAAGTGCTCAGGATCCTGACTTGGGCACCAACTCCATTCAAACTTACAAGCTTAGTGATAATGAATATTTTGCTTTGGATTTAAAGACTTTCAATGGAAATAGCAAGCTGATTGAGATTGTTCTGAAAAAAGCCTTAGACAGGGAGCAGAAACCTCTCCATCAGTTGCTTCTCACTGCCATAGATGGTGGCACTCCTGCTAAATCTGGCACTGCCCAGGTATCCGTACGGGTGATGGACACCAATGACAATACGCCATACTTTGATAAATCCACTTACAAGGCTAGTGTGCCTGANAATTCCCCAGCAGGCACGTTAGTCATTAAATTAAATGCCATTGATCCCGATGAAGGATCAAATGGAGATGTCTTATATTCTTTCAGCAGTTACACTCCGCAGAAAGTTAGACAGCTGTTCACTAT
                                                  Xt7.1-CHK-1008244138                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGCTTGGAGCAGCATAGCGGCCGGACCAGCCCAGGACTGCGGAGCTCATGGATCGCTACCGCTGGGGAAACGCTGCCGCCCCATTCAGCTCGGTGCCGCTACTCGCTATAGGAGCCATTACTGGCGCTGTCCGCGTCCCAAGTGCTGAAACCGAGCCAGCCGCGGCTTAGCGCCCCCTCCCTCCCCTCACAGCAGCTGAAGCGGACGGAGCAGCACACGGGATAAGCAGGCTACATGGTGGCAGCAGGAAGCGGGGTACAGCCATGGATTTATTGGGGAGACAGTCGCCCGGATCCCGCCCAGCACTGAGCGCTGCGCACAGATGGTAACACGCCGCAGTTTGGTAGATGTGGGATTATATACAAAAGGATGTGAGATAGATCCATGCTGGCTGGGGAGGGGTCGGGGGAGCGATTTTATCTGCTACAATGTCTGGTACCCGGGGTTGTACGGTGCTGCGGGCCCTCCGGTTGCTGCTGGTATTATCGGGCTGGGCGGCGGGGCAGCGGAGATACTCAGTAAGGGAGGAGCTCAGTCATGGGGCGTTTGTGGGCAACGTGGTGAGCGACCTGGGCTTGGATCTCAGGCTCCTACCCTCCCGGGGCTTTCGGATCGCGTCCGGTAACAGCAAACAGTATTTCGATGTGAATATCGGTAACGGGGTTTTATTTGTAAACCGAACCATAGACCGGGAAACTCTGTGCGACCCCGGCCCCCCCTGTCTCATCAACCTGGAGGTGGTTGTGGGGAACCCAGTGGAGGTGCACAACATCGAAGTAGAGATATTAGACATTAACGACAATGCTCCCAAATTCCCTAGAAATGAATATTATTTGGAGATCAGCGAGTCTGCCGTCCCTGGGGCCCGGTTTCCTATAGAAAGTGCTCAGGATCCTGACTTGGGCACCAACTCCATTCAAACTTACAAGCTTAGTGATAATGAATATTTTGCTTTGGATTTAAAGACTTTCAATGGAAATAGCAAGCTGATTGAGATTGTTCTGAAAAAAGCCTTAGACAGGGAGCAGAAACCTCTCCATCAGTTGCTTCTCACTGCCATAGATGGTGGCACTCCTGCTAAATCTGGCACTGCCCAGGTATCCGTACGGGTGATGGACACCAATGACAATACGCCATACTTTGATAAATCCACTTACAAGGCTAGTGTGCCTGANAATTCCCCAGCAGGCACGTTAGTCATTAAATTAAATGCCATTGATCCCGATGAAGGATCAAATGGAGATGTCTTATATTCTTTCAGCAGTTACACTCCGCAGAAAGTTAGACAGCTGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     271      51                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     424      88                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     436     197                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     436      12                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 1e-007     BAA92182.1 cadherin [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 7e-022     NP_498687.1 CaDHerin family member (cdh-3) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Cs ---- 8e-029     BAB68353.1 protocadherin [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-029     NP_523446.2 CG17941-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 7e-041     XP_787157.1 PREDICTED: similar to Protocadherin 9 precursor [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Xl ---- 5e-071     AAH57734.1 Unknown (protein for IMAGE:4959112) [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 8e-076     XP_692324.1 PREDICTED: similar to cadherin-related neuronal receptor variable 1 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dr ==== 2e-083     NP_878305.1 protocadherin 10b [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 5e-091     NP_061722.1 protocadherin alpha subfamily C, 2 isoform 1 precursor [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 4e-091     NP_001003672.1 protocadherin alpha subfamily C, 2 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 6e-105     XP_414464.2 PREDICTED: similar to cadherin-related neuronal receptor c02 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 1e-164     AAI36080.1 Unknown (protein for IMAGE:7662234) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAK11769.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAG------------------------------ATG---------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------TAA---------------TAGATG---------------------------TAG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  0   1   1           Brn2 FLt3                       CAAJ16142.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCATTGGAGCTTGGAGCAGCATAGCGGCCGGACCAGCCCAGGACTGCGGAGCTCATGGATCGCTACCGCTGGGGAAACGCTGCCGCCCCATTCAGCTCGGTGCCGCTACTCGCTATAGGAGCCATTACTGGCGCTGTCCGCGTCCCAAGTGCTGAAACCGAGCCAGCCGCGGCTTAGCGCCCCCTCCCTCCCCTCACAGCAGCTGAAGCGGACGGAGCAGCACACGGGATAAGCAGGCTACATGGTGGCAGCAGGAAGCGGGGTACAGCCATGGATTTATTGGGGAGACAGTCGCCCGGATCCCGCCCAGCACTGAGCGCTGCGCACAGATGGTAACACGCCGCAGTTTGGTAGATGTGGGATTATATACAAAAGGATGTGAGATAGATCCATGCTGGCTGGGGAGGGGTCGGGGGAGCGATTTTATCTGCTACAATGTCTGGTACCCGGGGTTGTACGGTGCTGCGGGCCCTCCGGTTGCTGCTGGTATTATCGGGCTGGGCGGCGGGGCAGCGGAGATACTCAGTAAGGGAGGAGCTCAGTCATGGGGCGTTTGTGGGCAACGTGGTGAGCGACCTGGGCTTGGATCTCAGGCTCCTACCCTCCCGGGGCTTTCGGATCGCGTCCGGTAACAGCAAACAGTATTTCGATGTGAATATCGGTAACGGGGTTTTATTTGTAAACCGAACCATAGACCGGGAAACTCTGTGCGACCCCGGCCCCCCCTGTCTCATCAACCTGGAGGTGGTTGTGGGGAACCCAGTGGAGGTGCACAACATCGAAGTAGAGATATTAGACATTAACGACAATGCTCCCAAATTCCCTAGAAATGAATATTATTTGGAGATCAGCGAGTCTGCCGTCCCTGGGGCCCGGTTTCCTATAGAAAGTGCTCAGGATCCTGACTTGGGCACCAACTCCATTCAAACTTACAAGCTTAGTGATAATGAATATTTTGCTTTGGATTTAAAGACTTTCAATGGAAATAGCAAGCTGATTGAGATTGTTCTGAAAAAAGCCTTAGACAGGGAGCAGAAACCTCTCCATCAGTTGCTTCTCACTGCCATAGATGGTGGCACTCCTGCTAAATCTGGCACTGCCCAGGTATCCGTACGGGTGATGGACACCAATGACAATACGCCATACTTTGATAAATCCACTTACAAGGCTAGTGTGCCTGAAAATTCCCCAGCAGGCACGTTAGTCATTAAATTAAATGCCATTGATCCCGATGAAGGATCAAATGGAGATGTCTTATATTCTTTCAGCAGTTACACTCCGCAGAAAGTTAGACAGCTGTTCACTATTGACCCACAAAAAGGAGAGATACGTATTAACGGTGCAGTGGATTATGAAAAGGCATCAGAATACGAGATCTATGTTCAAGCCACTGACAAAGGTACTGTCCCTATGGCCGGGCATTGCAAGGTGCTGGTCGAGATTGTGGATGTCAATGACAATGCCCCAGAAATAGTGGTAACATCCAATTACTCTCCAGTAGCCGAGAATTCTCATGATGAGACAGTCGTTGCACTAATGAGTGTAACAGACCAAGACTCTGGGTTGAACAAACAAGTTAGTCTCAGGATACAACCCAACATCCCATTTAAACTGACATCTTTTAAGAACACGTACAAACTAGTAACAGTTGGTAAACTGGACAGGGAAAAGTCTTCTTCCTACAATATTACAGTGACGGTCACAGATTCCGGGACTCCACCTTTGTCCACTCAAAAAACTCTGTATGTGGAAGTATCAGATCTAAATGACAACCCCCCTACATTTGAGGAAAAGTCTTACTCTATTTATATAATGGAAAACAATGCTCCCGGGGTGTCCCTGATCTCAGTAAAAGCTACTGATCTAGATTCCAATGAAAACTCATTTGTTTCATACTCACTTCTAAGAGGTGATATTGAAGGGCTACCGGTCAGTTCTTATGTCTCAATCAAATCAGACAATGGAACTATCTATGCTGTACATTCCTTCGACTATGAAAAACTGAGGGAATTTCATTTTGTTGTTCAAGCACAAGATGCAGGGAACCCATCACTTAGCAGCTCTGCCACCGTAAATATTTTTATTATGGATCAAAATGATCACGCTCCTACCATTTTATTCCCATCTACTGCCAATGGTTCTGCATCAATCGAGATGATACCTCGATCGGCTAATGTTGGTTATCTAGTCGCTAAAGTAATTGCCATTGATTTGGACTCAGGTCAGAATGCTTGGTTGTTTTACAACTTGTCTCAAGCTTCAGACCCTAAACTTTTCCAAGTGGAGTTACACACGGGAGAGATAAGGACTACAAGGAAGGTCGTAGATGACAGTATTACTAACTACAATTTAACTATTCTAGTACGAGACAATGGTCAGCCTTCCCTTTCTTCTTCTGCCACTATAAGTGTTGTGGTTGTAGACAGGGTTCCAAAAACCATCCCTGACACGGGGAGACTTATTCAAAATAACACCAACCTTTCAGAAATAACCATTTACTTGATCATTGCACTGTGCTCAATTTCATTTGTGTTTCTTCTGACAGTCATTGTTCTAATTATCATTAAATGCTTCAAATGCAGTGAGTCCGGGGGCTGTTGTGCTGGGGCCTGTGGCCAGAGGCAGCCAAACCCAGCTGACATCTATAAGCAGGCAAACAATAACATTGAAACTCGATTGCCACCTGGTTTAAAAGTGCAGCCACATTTCATTGAAGTTAGAGGGAATGGCTCTCTTACAAAAACTTACTGCTACAAGGCCTGCTTGACGGCTGGATCGGGAAGTGACACTTTTATGTTTTATAACACTGGAGCTGGTCCCATTGTGCCTGCCACTCATGTGGTGGCTACAGACAGACATGTGACAGCGCAAAATAGACACAGCGTGCAAAACCTGATCATTTTGAAAAGTGAAACCACAACTCCAGTTGAGCCCAAACATCCTCATCCAGACTGGCGTTACTCTGCTTCACTCAGAGCTGCAATGCAGGGCGCTGTGCACATGGAAGGAGCAGCAGTTTTACGCGGAGGAGCGGGCGGTCTTGAGCAGCAATGGCCGACGGTGTCCAGCGCAACACCAGAACCTGAAGGAGGAGAAGTATCTCCCCCTGTTGGAGCTGGCGTAAACTGCAACAGTTGGACCTTCAAGTACGGCCCGGGCAATCCAAAACAACCAGTGCCACAAATCCCCCCTGATTTCCCAGAGAATTTCATTATCCCTGGATCACCAGCCATTATTTCAATCCGCCAGGATCAGCCATCGGCTCAAAACCAGAAAAGCAACTTCATAACATTTGGTAAGAAAGAGGAAACCAAGAAGAAGAAAAAAAAAAAAAAA
  0   1   1           Brn3 FLt3                       CAAK11769.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCAGGCTACATGGTGGCAGCAGGAAGCGGGGTACAGCCATGGATTTATTGGGGAGACAGTCGCCCGGATCCCGCCCAGCACTGAGCGCTGCGCACAGATGGTAACACGCCGCAGTTTGGTAGATGTGGGTTTATATACAAAAGGATGTGAGATAGATCCATGCTGGCTGGGGAGGGGTCGGGGGAGCGATTTTATCTGCTACAATGTCTGGTACCCGGGGTTGTACGGTGCTGCGGGCCCTCCGGTTGCTGCTGGTATTATCGGGCTGGGCGGCGGGGCAGCGGAGATACTCAGTAAGGGAGGAGCTCAGTCACGGGGCGTTTGTGGGCAACGTGGTGAGCGACCTGGGCTTGGATCTCAGGCTCCTACCCTCCCGGGGCTTTCGGATCGCGTCCGGTAACAGCAAACAGTATTTCGATGTGAATATCGGTAACGGGGTTTTATTTGTAAACCGAACCATAGACCGGGAAACTCTGTGCGACCCCGGCCCCCCCTGTCTCATCAACCTGGAGGTGGTTGTGGGGAACCCAGTGGAGGTGCACAACATCGAAGTAGAGATATTAGACATTAATGACAATGCTCCCAAATTCCCTAGAAATGAATATTATTTGGAGATCAGCGAGTCTGCCGTCCCTGGGGCCCGGTTTCCTATAGAAAGTGCTCAGGATCCTGACTTGGGCACCAACTCCATTCAAACTTACAAGCTTAGTGATAATGAATATTTTGCTTTGGATTTAAAGACTTTCAATGGAAATAGCAAGCTGATTGAGATTGTTCTGAAAAAAGCCTTAGACAGGGAGCAGAAACCTCTCCATCAGTTGCTTCTCACTGCCATAGATGGTGGCACTCCTGCTAAATCTGGCACTGCCCAGGTATCCGTACGGGTGATGGACACCAATGACAATACGCCATACTTTGATAAATCCACTTACAAGGCTAGTGTGCCTGAAAATTCCCCAGCAGGCACGTTAGTCATTAAATTAAATGCCATTGATCCCGATGAAGGATCAAATGGAGATGTCTTATATTCTTTCAGCAGTTACACTCCGCAGAAAGTTAGACAGCTGTTCACTATTGACCCACAAAAAGGAGAGATACGTATTAACGGTGCAGTGGATTATGAAAAGGCATCAGAATACGAGATCTATGTTCAAGCCACTGACAAAGGTACTGTCCCTATGGCCGGGCATTGCAAGGTGCTGGTCGAGATTGTGGATGTCAATGACAATGCCCCAGAAATAGTGGTAACATCCAGTTACTCTCCAGTAGCCGAGAATTCTCACGATGAGACAGTCGTTGCACTAATGAGTGTAACAGACCAAGACTCTGGGTTGAACAAACAAGTTAGTCTCAGGATACAACCCAACATCCCATTTAAACTGACATCTTTTAAGAACACGTACAAACTAGTAACAGTTGGTAAACTGGACAGGGAAAAGTCTTCTTCCTACAATATTACAGTGACGGCCACAGATTCCGGGACTCCACCTTTGTCCACTCAAAAAACTCTGTATGTGGAAGTATCAGATCTAAATGACAACCCCCCTACATTTGAGGAAAAGTCTTACTCTATTTATATAATGGAAAACAATGCTCCCGGGGTGTCCCTGATCTCAGTAAAAGCTACTGATCTAGATTCCAATGAAAACTCATTTGTTTCATACTCACTTCTAAGAGGTGATATTGAAGGGCTACCGGTCAGTTCTTATGTCTCAATCAAATCAGACAATGGAACTATCTATGCTGTACATTCCTTCGACTATGAAAAACTGAGGGAATTTCATTTTGTTGTTCAAGCACAAGATGCAGGGAACCCATCACTTAGCAGCTCTGCCACCGTAAATATTTTTATTATGGATCAAAATGATCACGCTCCTACCATTTTATTCCCATCTACTGCCAATGGTTCTGCATCAATCGAGATGATACCTCGATCGGCTAATGTTGGTTATCTAGTCGCTAAAGTAATTGCCATTGATTTGGACTCAGGTCAGAATGCTTGGTTGTTTTACAACTTGTCTCAAGCTTCAGACCCTAAACTTTTCCAAGTGGAGTTACACATGGGAGAGATAAGGACTACAAGGAAGGTCGTAGATGACAGTATTACTAACTACAATTTAACTATTCTTGTACGAGACAATGGTCAGCCTTCCCTTTCTTCTTCTGCCACTATAAGTGTTGTGGTTGTAGACAGGGTTCCAAAAACCATCCCTGACACGGGGAGACTTATTCAAAATAACACCAACCTTTCAGAAATAACCATTTACTTGATTATTGCACTGTGCTCAATTTCATTTGTGTTTCTTCTGACAGTCATTGTTCTAATTATCATTAAATGCTTCAAATGCAGTGAGTCCGGGGGCTGTTGTGCTGGGGCCTGTGGCCAGAGGCAGCCAAACCCAGCTGACATCTATAAGCAGGCAAACAATAACATTGAAACTCGATTGCCACCTGGTTTAAAAGTGCAGCCACATTTCATTGAAGTTAGAGGGAATGGCTCTCTTACAAAAACTTACTGCTACAAGGCCTGCTTGACGGCTGGATCGGGAAGTGACACTTTTATGTTTTATAACACTGGAGCTGGTCCCATTGTGCCTGCCACTCATGTGGTGGCTACAGACAGACACGTGACAGCGCAAAATAGACACAGCGTGCAAAACCTGATCATTTTGAAAAGTGAAACCACAACTCCAGTTGAGCCCAAACATCCTCATCCAGACTGGCGTTACTCTGCTTCACTCAGAGCTGCAATGCAGGGCGCTGTGCACATGGAAGGAGCAGCAGTTTTACGCGGAGGAGCGGGCGGTCTTGAGCAGCAATGGCCGACGGTGTCCAGCGCAACACCAGAACCTGAAGGAGGAGAAGTATCTCCCCCTGTTGGAGCTGGCGTAAACTGCAACAGTTGGACCTTCAAGTACGGCCCGGGCAATCCAAAACAACCAGTGCCACAAATCCCCCCTGATTTCCCAGAGAATTTCATTATCCCTGGATCACCAGCCATTATTTCAATCCGCCAGGATCAGCCATCGGCTCAAAACCAGAAAAGCAACTTCATAACATTTGGTAAGAAAGAGGAAACCAAGAAGAAGAAAAAAAAAAAAAAA
  5   1   2      seed Brn2 FLt3 out                       CAAJ16142.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCATTGGAGCTTGGAGCAGCATAGCGGCCGGACCAGCCCAGGACTGCGGAGCTCATGGATCGCTACCGCTGGGGAAACGCTGCCGCCCCATTCAGCTCGGTGCCGCTACTCGCTATAGGAGCCATTACTGGCGCTGTCCGCGTCCCAAGTGCTGAAACCGAGCCAGCCGCGGCTTAGCGCCCCCTCCCTCCCCTCACAGCAGCTGAAGCGGACGGAGCAGCACACGGGATAAGCAGGCTACATGGTGGCAGCAGGAAGCGGGGTACAGCCATGGATTTATTGGGGAGACAGTCGCCCGGATCCCGCCCAGCACTGAGCGCTGCGCACAGATGGTAACACGCCGCAGTTTGGTAGATGTGGGATTATATACAAAAGGATGTGAGATAGATCCATGCTGGCTGGGGAGGGGTCGGGGGAGCGATTTTATCTGCTACAATGTCTGGTACCCGGGGTTGTACGGTGCTGCGGGCCCTCCGGTTGCTGCTGGTATTATCGGGCTGGGCGGCGGGGCAGCGGAGATACTCAGTAAGGGAGGAGCTCAGTCATGGGGCGTTTGTGGGCAACGTGGTGAGCGACCTGGGCTTGGATCTCAGGCTCCTACCCTCCCGGGGCTTTCGGATCGCGTCCGGTAACAGCAAACAGTATTTCGATGTGAATATCGGTAACGGGGTTTTATTTGTAAACCGAACCATAGACCGGGAAACTCTGTGCGACCCCGGCCCCCCCTGTCTCATCAACCTGGAGGTGGTTGTGG
  5   1   2       bld HdA       out                  THdA038l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCATAGCGGCCGGACCAGCCCACTATGCGGAGCTCATGGATCGCTACCGCTGGGGAAACGCTGCCGCCCCATTCAGCTCGGTGCCGCTACTCGCTATAGGAGCCATTACTGGCGCTGTCCGCGTCCCAAGTGCTGAAACCGAGCCAGCCGCGGCTTAGCGCCCCCTCCCTCCCCTCACAGCAGCTGAAGCGGACGGAGCAGCACACGGGATAAGCAGGCTACATGGTGGCAGCAGGAAGCGGGGTACAGCCATGGATTTATTGGGGAGACAGTCGCCCGGATCCCGCCCAGCACTGAGCGCTGCGCACAAATGGTAACACGCCGCAGTTTGGTAGATGTGGGT
  5   1   2       bld Brn3 FLt3 out                       CAAK11769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGCTACATGGTGGCAGCAGGAAGCGGGGTACAGCCATGGATTTATTGGGGAGACAGTCGCCCGGATCCCGCCCAGCACTGAGCGCTGCGCACAGATGGTAACACGCCGCAGTTTGGTAGATGTGGGTTTATATACAAAAGGATGTGAGATAGATCCATGCTGGCTGGGGAGGGGTCGGGGGAGCGATTTTATCTGCTACAATGTCTGGTACCCGGGGTTGTACGGTGCTGCGGGCCCTCCGGTTGCTGCTGGTATTATCGGGCTGGGCGGCGGGGCAGCGGAGATACTCAGTAAGGGAGGAGCTCAGTCACGGGGCGTTTGTGGGCAACGTGGTGAGCGACCTGGGCTTGGATCTCAGGCTCCTACCCTCCCGGGGCTTTCGGATCGCGTCCGGTAACAGCAAACAGTATTTCGATGTGAATATCGGTAACGGGGTTTTATTTGTAAACCGAACCATAGACCGGGAAACTCTGTGCGACCCCGGCCCCCCCTGTCTCATCAACCTGGAGGTGGTTGTGGGGAACCCAGTGGAGGTGCACAACATCGAAGTAGAGATATTAGACATTAATGACAATGCTCCCAAATTCCCTAGAAATGAATATTATTTGGAGATCAGCGAGTCTGCCGTCCCTNGGGCCCGGTTTCCTATAGAAAGTGCTCANGATCCTGACTTGNGCACCAACTCCATTCAAACTTACAAGCTTAGTGATAATGAATATTTTG
  5   1   2       bld Brn3      out                       CAAK10146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGGGCCCTCCGGTTGCTGCTGGTATTATCGGGCTGGGCGGCGGGGCAGCGGAGATACTCAGTAAGGGAGGAGCTCAGTCATGGGGCGTTTGTGGGCAACGTGGTGAGCGACCTGGGCTTGGATCTCAGGCTCCTACCCTCCCGGGGCTTTCGGATCGCGTCCGGTAACAGCAAACAGTATTTCGATGTGAATATCGGTAACGGGGTTTTATTTGTAAACCGAACCATAGACCGGGAAACTCTGTGCGACCCCGGCCCCCCCTGTCTCATCAACCTGGAGGTGGTTGTGGGGAACCCAGTGGAGGTGCACAACATCGAAGTAGAGATATTAGACATTAACGACAATGCTCCCAAATTCCCTAGAAATGAATATTATTTGGAGATCAGCGAGTCTGCCGTCCCTGGGGCCCGGTTTCCTATAGAAAGTGCTCAGGATCCTGACTTGGGCACCAACTCCATTCAAACTTACAAGCTTAGTGATAATGAATATTTTGCTTTGGATTTAAAGACTTTCAATGGAAATAGCAAGCTGATTGAGATTGTTCTGAAAAAAGCCTTAGACAGGGAGCAGAAACCTCTCCATCAGTTGCTTCTCACTGCCATAGATGGTGGCACTCCTGCTAAATCTGGCACTGCCCAGGTATCCGTACGGGTGATGGACACCAATGACAATACGCCATACTTTGATAAATCCACTTACAAGGCTAGTGTGCCTGANAATTCCCCAGCAGGCACGTTAGTCATTAAATTAAATGCCATTGATCCCGATGAAGGATCAAATGGAGATGTCTTATATTCTTTCAGCAGTTACACTCCGCAGAAAGTTAGACAGCTGTTCACTATTGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)