Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CACX1382.5                            2 END     1          25       50                LOC496349 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 216.0    0Xt7.1-CACX1382.5                            2 PI      100        13      125                LOC496349 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012097639 Xt7.1-CACX1382.3 - 4 ESTs
                                                                       ....-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CACX1382.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGCGATCTAGAACGCGGTCGGCCATGGTGGCCCAGGGCATGGTGGAAACGCAAGTCTTCGTGTCTCACCTGCTATCCATCCGGTCCCTGTGGGCCGACACCGGCATACAGACGGCTTACGACCGGCGCCGAGAATTCCAGTTGGGGGAGTCAGTGAAGTATTTCTTGGACAATCTGGACAAGTTGGGCGACAAGGACTATCTCCCAAGCCAGCAAGACATCCTGCTAGCCCGGCGGCCCACCAAAGGCATCCACGAGTATGACTTCGAGATCAAGAACGTCCCCTTCAAGATGGTGGACGTGGGCGGGCAGCGGTCGGAGCGCAAGCGCTGGTTCGAGTGTTTCGACAGCGTCACCTCCATCCTGTTCCTGGTGTCGTCGAGCGAATACGACCAAGTGCTGATGGAGGACCGACAGACCAACCGCCTGACCGAGTCGCTCAACATCTTCGAGACCATCGTGAACAACCGCGTGTTCAGCAACGTCTCCATCATCCTGTTCCTCAACAAGACGGACTTGCTGGAGGAGAAGGTGCGGATAGTCAGCATCAAGGACTACTTTGCCGATTTCGAGGGCGACCCCCACTGCCTGGAGGATGTGCAGAAGTTCCTGGTAAATTGCTTCCGGAACAAGCGGCGGGATCAGCAGCAGAAGCCGCTCTACCACCACTTCACCACCGCCATAAACACGGAGAACATTCGCCTGGTTTTCCGCGACGTGAAAGATACCATTCTCCACGACAACCTCAAACAGTTGATGCTGCAGTAACGACTTTTATCCGGGTTTTTATTTGCCATTTTATAGGCTTTGTTTCCCCTTTTTTTTAAGTTTACATCATGAGAGGCAAATTGCGTTTTATTTTTTTTTTTTAATTTGCGGGGCGAGTGCCCTCAGCTTCTATTGGACGCCTGGCTGAACGCTCCCCTTCTACATAGTATTGCCGAAGAGAAGCCTCGCTCTGAGCGACAGATTCACGCCATTGCGGCCGTCCTGCACGGCTCCCACCGGCCTCAACGTCGCAGGAAATGCGCTCACTTCCATACGGATGATTTGATTTCTTCTCAGTTGCCAACTTGTGGGTCTGATGCTTCAGCCGCAGGGATGCGCAGCTACCAGCCCCCTCCCCCGCTGGCAGCTGAAGGGTTAAGATGCCGGGAGTTGCCATTGAGCTTCCTATAACTGCTGTTAGTGCTGTGCCTTTGCCCAGAGATAAGCACAAAAAAA
                                                  Xt7.1-CHK-1008245096                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTAGAACGCGGTCGGCCATGGTGGCCCAGGGCATGGTGGAAACGCAAGTCTTCGTGTCTCACCTGCTATCCATCCGGTCCCTGTGGGCCGACACCGGCATACAGACGGCTTACGACCGGCGCCGAGAATTCCAGTTGGGGGAGTCAGTGAAGTATTTCTTGGACAATCTGGACAAGTTGGGCGACAAGGACTATCTCCCAAGCCAGCAAGACATCCTGCTAGCCCGGCGGCCCACCAAAGGCATCCACGAGTATGACTTCGAGATCAAGAACGTCCCCTTCAAGATGGTGGACGTGGGCGGGCAGCGGTCGGAGCGCAAGCGCTGGTTCGAGTGTTTCGACAGCGTCACCTCCATCCTGTTCCTGGTGTCGTCGAGCGAATACGACCAAGTGCTGATGGAGGACCGACAGACCAACCGCCTGACCGAGTCGCTCAACATCTTCGAGACCATCGTGAACAACCGCGTGTTCAGCAACGTCTCCATCATCCTGTTCCTCAACAAGACGGACTTGCTGGAGGAGAAGGTGCGGATAGTCAGCATCAAGGACTACTTTGCCGATTTCGAGGGCGACCCCCACTGCCTGGAGGATGTGCAGAAGTTCCTGGTAAATTGCTTCCGGAACAAGCGGCGGGATCAGCAGCAGAAGCCGCTCTACCACCACTTCACCACCGCCATAAACACGGAGAACATTCGCCTGGTTTTCCGCGACGTGAAAGATACCATTCTCCACGACAACCTCAAACAGTTGATGCTGCAGTAACGACTTTTATCCGGGTTTTTATTTGCCATTTTATAGGCTTTGTTTCCCCTTTTTTTTAAGTTTACATCATGAGAGGCAAATTGCGTTTTATTTTTTTTTTTTAATTTGCGGGGCGAGTGCCCTCAGCTTCTATTGGACGCCTGGCTGAACGCTCCCCTTCTACATAGTATTGCCGAAGAGAAGCCTCGCTCTGAGCGACAGATTCACGCCATTGCGGCCGTCCTGCACGGCTCCCACCGGCCTCAACGTCGCAGGAAATGCGCTCACTTCCATACGGATGATTTGATTTCTTCTCAGTTGCCAACTTGTGGGTCTGATGCTTCAGCCGCAGGGATGCGCAGCTACCAGCCCCCTCCCCCGCTGGCAGCTGAAGGGTTAAGATGCCGGGAGTTGCCATTGAGCTTCCTATAACTGCTGTTAGTGCTGTGCCTTTGCCCAGAGATAAGCACAAAAAAATTGTTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       PROTEIN --- Sc ---- 1e-047     NP_011868.1 Involved in the mating pheromone signal transduction pathway; component ofpheromone response pathway common to both a and alpha cells.; Gpa1p[Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 9e-054     BAB83918.1 G protein alpha subunit Gi splicing variant CiGi1b [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 6e-064     CAJ81392.1 guanine nucleotide binding protein (G protein), q polypeptide [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 4e-072     NP_509557.1 G Protein, Alpha subunit (42.0 kD) (gpa-12) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                PROTEIN --- Dm ---- 1e-072     NP_001036421.1 concertina CG17678-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sp ---- 1e-086     NP_001001476.1 guanine nucleotide-binding protein G(12) alpha subunit [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 2e-125     NP_001012243.2 guanine nucleotide binding protein (G protein), alpha 13 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 1e-129     NP_034433.3 guanine nucleotide binding protein, alpha 13 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 2e-130     XP_415686.1 PREDICTED: similar to guanine nucleotide binding protein (G protein), alpha 13 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 3e-131     NP_006563.2 guanine nucleotide binding protein (G protein), alpha 13 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 9e-139     AAH88948.1 LOC496349 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 9e-139     NP_001088969.1 hypothetical protein LOC496349 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CACX1382.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAA---------------------------------TAG---------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  3  -1   2       bld Gas7      in                         XZG29122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGCGATCTAGAACGCGGTCGGCCATGGTGGCCCAGGGCATGGTGGAAACGCAAGTCTTCGTGTCTCACCTGCTATCCATCCGGTCCCTGTGGGCCGACACCGGCATACAGACGGCTTACGACCGGCGCCGAGAATTCCAGTTGGGGGAGTCAGTGAAGTATTTCTTGGACAATCTGGACAAGTTGGGCGACAAGGACTATCTCCCAAGCCAGCAAGACATCCTGCTAGCCCGGCGGCCCACCAAAGGCATCCACGAGTATGACTTCGAGATCAAGAACGTCCCCTTCAAGATGGTGGACGTGGGCGGGCAGCGGTCGGAGCGCAAGCGCTGGTTCGAGTGTTTCGACAGCGTCACCTCCATCCTGTTCCTGGTGTCGTCGAGCGAATACGACCAAGTGCTGATGGAGGACCGACAGACCAACCGCCTGACCGAGTCGCTCAACATCTTCGAGACCATCGTGAACAACCGCGTGTTCAGCAACGTCTCCATCATCCTGTTCCTCAACAAGACGGACTTGCTGGAGGAGAAGGTGCGGATAGTCAGCATCAAGGACTACTTTGCCGATTTCGAGGGCGACCCCCACTGCCTGGAGGATGTGCAGAAGTTCCTGGTAAATTGCTTCCGGAACAAGCGGCGGGATCAGCAGCAGAAGCCGCTCTACCACCACTTCACCACCGCCATAAACACGGAGAACATTCGCCTGGTTNTCCGCGACGTGAAAG
  3   1   2      seed Met5 PIPE out                        CACX1382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAACGTCTCCATCATCCTGTTCTCAACAAAGACGGACTTGCTGGAGGAGAAGGTGCGGATAGTCAGCATCAAGGACTACTTTGCCGATTTCGAGGGCGACCCCCACTGCCTGGAGGATGTGCAGAAGTTCCTGGTAAATTGCTTCCGGAACAAGCGGCGGGATCAGCAGCAGAAGCCGCTCTACCACCACTTCACCACCGCCATAAACACGGAGAACATTCGCCTGGTTTTCCGCGACGTGAAAGATACCATTCTCCACGACAACCTCAAACAGTTGATGCTGCAGTAACGACTTTTATCCGGGTTTTTATTTGCCATTTTATAGGCTTTGTTTCCCCTTTTTTTTAAGTTTACATCATGAGAGGCAAATTGCGTTTTATTTTTTTTTTTTAATTTGCGGGGCGAGTGCCCTCAGCTTCTATTGGACGCCTGGCTGAACGCTCCCCTTCTACATAGTATTGCCGAAGAGAAGCCTCGCTCTGAGCGACAGATTCACGCCATTGCGGCCGTCCTGCACGGCTCCCACCGGCCTCAACGTCGCAGGAAATGCGCTCACTTCCATACGGATGATTTGATTTCTTCTCAGTTGCCAACTTGTGGGTCTGATGCTTCAGCCGCAGGGATGCGCAGCTACCAGCCCCCTCCCCCGCTGGCAGCTGAAGGGTTAAGATGCCGGGAGTTGCCATTGAGCTTCCTATAACTGCTGTTAGTGCTGTGCCTTTGCCCAGAGATAAGCACAAAAAAATTGTTTT
  5  -1   2       bld Gas7      in                         XZG29122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTCGAGGGCGACCCCCACTCCTGGAGGATGTGCAGAAGTTCCTGGTAAATTGCTTCCGGAACAAGCGGCGGGATCAGCAGCAGAAGCCGCTCTACCACCACTTCACCACCGCCATAAACACGGAGAACATTCGCCTGGTTTTCCGCGACGTGAAAGATACCATTCTCCACGACAACCTCAAACAGTTGATGCTGCAGTAACGACTTTTATCCGGGTTTTTATTTGCCATTTTATAGGCTTTGTTTCCCCTTTTTTTTAAGTTTACATCATGAGAGGCAAATTGCGTTTTATTTTTTTTTTTTAATTTGCGGGGCGAGTGCCCTCAGCTTCTATTGGACGCCTGGCTGAACGCTCCCCTTCTACATAGTATTGCCGAAGAGAAGCCTCGCTCTGAGCGACAGATTCACGCCATTGCGGCCGTCCTGCACGGCTCCCACCGGCCTCAACGTCGCAGGAAATGCGCTCACTTCCATACGGATGATTTGATTTCTTCTCAGTTGCCAACTTGTGGGTCTGATGCTTCAGCCGCAGGGATGCGCAGCTACCAGCCCCCTCCCCCGCTGGCAGCTGAAGGGTTAAGATGCCGGGAGTTGCCATTGAGCTTCCTATAACTGCTGTTAGTGCTGTGCCTTTGCCCAGAGATAAGCACAAAAAAATTGTTTTTAAAAAAAAAAAAAGGGCGGCCCTCGCGATCAGAACTAGT
  5   1   2       bld Gas7                                 XZG51930.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTTTCCCCTTTTTTTCACTTTCACCTCCTGATAGGCAAGTTGCGTTTTATTTTTTTTTTTTAATTTGCGGGGCGAGTGCCCTCAGCTTCTATTGGACGCCTGGCTGAACGCTCCCCTTCTACATAGTATTGCCGAAGAGAAGCCTCGCTCTGAGCGACAGATTCACGCCATTGCGGCCGTCCTGCACGGCTCCCACCGGCCTCAACGTCGCAGGAAATGCGCTCACTTCCATACGGATGATTTGATTTCTTCTCAGTTGCCAACTTGTGGGTCTGATGCTTCAGCCGCAGGGATGCGCAGCTACCATCCCCCTCCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)