Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT24522.3                            4 END     2          50       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 185.0    0Xt7.1-CABJ7910.3.5                         31 PI      85       1571     1734                MGC147344 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012097813 Xt7.1-XZG38999.3 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG38999.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAGAGTCCGCAGCAGTTTAAGCAGCTTCTCATAATTGGTGGGCTGGACAGATACTTCCAAATAGCAAGATGCTATCGGGATGAGGGATCGAAGCCAGATCGTCAGCCTGAGTTCACACAGGTAGATATTGAGATGTCCTTTGTGGATCAGGCTGGTATCCAGAGTCTGGTGGAAGGAATGCTGCGTTTTTCTTGGCCAGAGGAGAAAGGACCCCTCCAAGCCCCATTCCCAGTTATGAGTTATGCAGATGCCATGAGCAGCTATGGGGTTGATAAGCCAGATACACGCTTTGAGATGAAGATCCAGGATGTGACAAGCCAGTTTAGGGAAGTGCAGCTGGGGTATGTGCAGGAAACTCTGAGAAAACCCCATGGATGTGTAAAAGCCATTTGCATTCCAGGAGGAGCTAAATTCATTAAAAGGAAAGAGCTGGATTCCATGCAAGAGCTTGTAAAGCAGCAGTATAACCAGGAAGTAGTGCCAGTTATCCTGAGGGCAGACAGTAGCTGGAAATCCCCTTTGGAGAAGTTTCTCAGTGCGAAGCTGAAGGAAAGCCTCACAGAAGCAATGGAAGCCAAGTCTGAGGACATTCTCTTGTTTGCAGCGGGGGAGCATATTCGAGCATGTTCTGCTTTGGGTAAGCTGCGACTGGATGCCGCCGCTCAGCTAGAAGAGTATGGGGTTCCTTTGCGGGACCCCACTGCCTTTCATTTCCTGTGGGTTGTAGACTTCCCACTCTTTCTCCCTAAAGAAGATAACGAGTTAGAGCTGGAATCTGCTCACCACCCTTTCACTGCCCCTCATCCCGAGGACACTGCTCTTCTGCATACAGATCCAGCAAAGGTTCGAAGCCAACACTATGACCTGGTTTTGAATGGCAGTGAGGTTGGAGGGGGTTCAATTCGTATTCATAATTCAAATTTGCAGCGCTGGGTCCTACAGGATGTATTAAAGGAAGACGTGTCTCTTCTTTCTCACCTGCTGGAGGCCCTGCAGTCAGGGGCACCCCCACATGGAGGCATTGCTTTAGGACTTGATCGGCTCATTGCAATTATTGTCGGAGCACCCAGCATTCGTGATGTCATTGCCTTTCCGAAATCATTCCGGGGACGTGACCTTATGAGTAATGCGCCCGACATGGTGTCTGCTGAGGATCTCCAGCAATATCACATTCAGGTGATCCCTCCATGTACTGAATCTAGTGGAAAATGAATGACCAACAACATGAATTCCATGAAGCTAAGGAAGTGAACACTAAGTTTACACTTGAAGCACTTCAGTTTCTCTGCCAAACTATTTTTGTGCTGCTCAAAAATTCATTAGACCGTAAATAATGGACTAGAATGTGTAAAAACTGCTAATGTCTTGAAAACCAGAAAAAAAAAAATCTAAATTGGGGGCTAATTTTCATTTAGATTTGTATGTTTACTTCTAATAAAGGGGTGGTTCACCTTTAAAGTGATACTGACACCAGAAAACACTCTTCAAAATATAAATGTACATTAAAAGTTACCTATAGGTCATGCTGATCGTTTTTCACTGATAGGTTTGCTTTAGAAGTTCCTAAACCTGTCAGTAATGGATTCTAATGCTAACTGACTCCTGCTGCACAAATATGGCAGCCCCCTCATAGAGCATGGGGGATCAGATAGGTAATGTAAAAGCATCTGGCTTTTATGGGAAAATGATAAATAGCATGCAAAGACATTGTTAGATCGTGTCAGTATCTCTTAAAGTAACTTTTATCATGTTATAGAATAGCCAATTCTATGCA
                                                  Xt7.1-CHK-1008244127                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCCGCAGCAGTTTAAGCAGCTTCTCATAATTGGTGGGCTGGACAGATACTTCCAAATAGCAAGATGCTATCGGGATGAGGGATCGAAGCCAGATCGTCAGCCTGAGTTCACACAGGTAGATATTGAGATGTCCTTTGTGGATCAGGCTGGTATCCAGAGTCTGGTGGAAGGAATGCTGCGTTTTTCTTGGCCAGAGGAGAAAGGACCCCTCCAAGCCCCATTCCCAGTTATGAGTTATGCAGATGCCATGAGCAGCTATGGGGTTGATAAGCCAGATACACGCTTTGAGATGAAGATCCAGGATGTGACAAGCCAGTTTAGGGAAGTGCAGCTGGGGTATGTGCAGGAAACTCTGAGAAAACCCCATGGATGTGTAAAAGCCATTTGCATTCCAGGAGGAGCTAAATTCATTAAAAGGAAAGAGCTGGATTCCATGCAAGAGCTTGTAAAGCAGCAGTATAACCAGGAAGTAGTGCCAGTTATCCTGAGGGCAGACAGTAGCTGGAAATCCCCTTTGGAGAAGTTTCTCAGTGCGAAGCTGAAGGAAAGCCTCACAGAAGCAATGGAAGCCAAGTCTGAGGACATTCTCTTGTTTGCAGCGGGGGAGCATATTCGAGCATGTTCTGCTTTGGGTAAGCTGCGACTGGATGCCGCCGCTCAGCTAGAAGAGTATGGGGTTCCTTTGCGGGACCCCACTGCCTTTCATTTCCTGTGGGTTGTAGACTTCCCACTCTTTCTCCCTAAAGAAGATAACGAGTTAGAGCTGGAATCTGCTCACCACCCTTTCACTGCCCCTCATCCCGAGGACACTGCTCTTCTGCATACAGATCCAGCAAAGGTTCGAAGCCAACACTATGACCTGGTTTTGAATGGCAGTGAGGTTGGAGGGGGTTCAATTCGTATTCATAATTCAAATTTGCAGCGCTGGGTCCTACAGGATGTATTAAAGGAAGACGTGTCTCTTCTTTCTCACCTGCTGGAGGCCCTGCAGTCAGGGGCACCCCCACATGGAGGCATTGCTTTAGGACTTGATCGGCTCATTGCAATTATTGTCGGAGCACCCAGCATTCGTGATGTCATTGCCTTTCCGAAATCATTCCGGGGACGTGACCTTATGAGTAATGCGCCCGACATGGTGTCTGCTGAGGATCTCCAGCAATATCACATTCAGGTGATCCCTCCATGTACTGAATCTAGTGGAAAATGAATGACCAACAACATGAATTCCATGAAGCTAAGGAAGTGAACACTAAGTTTACACTTGAAGCACTTCAGTTTCTCTGCCAAACTATTTTTGTGCTGCTCAAAAATTCATTAGACCGTAAATAATGGACTAGAATGTGTAAAAACTGCTAATGTCTTGAAAACCAGAAAAAAAAAAATCTAAATTGGGGGCTAATTTTCATTTAGATTTGTATGTTTACTTCTAATAAAGGGGTGGTTCACCTTTAAAGTGATACTGACACCAGAAAACACTCTTCAAAATATAAATGTACATTAAAAGTTACCTATAGGTCATGCTGATCGTTTTTCACTGATAGGTTTGCTTTAGAAGTTCCTAAACCTGTCAGTAATGGATTCTAATGCTAACTGACTCCTGCTGCACAAATATGGCAGCCCCCTCATAGAGCATGGGGGATCAGATAGGTAATGTAAAAGCATCTGGCTTTTATGGGAAAATGATAAATAGCATGCAAAGACATTGTTAGATCGTGTCAGTATCTCTTAAAGTAACTTTTATCATGTTATAGAATAGCCAATTCTATGCAGCTTTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Sc ---- 9e-057     NP_015221.1 Mitochondrial aspartyl-tRNA synthetase, required for acylation of aspartyl-tRNA; yeast and bacterial aspartyl-, asparaginyl-, and lysyl-tRNA synthetases contain regions with high sequence similarity, suggesting a common ancestral gene [Saccharomyces cerevi ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 2e-077     NP_506019.2 aspartyl(D) tRNA Synthetase (drs-2C) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 6e-088     NP_724018.1 CG31739-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 2e-137     XP_422251.2 PREDICTED: hypothetical protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Dr ---- 2e-151     XP_699804.1 PREDICTED: similar to FLJ10514 protein [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 1e-151     NP_766232.1 RIKEN cDNA 5830468K18 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Hs ---- 8e-160     NP_060592.2 hypothetical protein LOC55157 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG38999.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------ATG------------------------------------------------------ATG---------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------TGAATG---------ATG------ATG------------TGA---------------------------------------------------------------------TAG------------------------------------------------------------------TAA---------TAA---------------------------------------------------------------------------------------------------TAA------------------------------------------------TAG---------------------ATG---------------TGA------------------------------------------------------TAA------------------------------------TAG------------------------------------TAA------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Gas7 PIPE in                         XZG38999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAGAGTCCGCAGCAGTTTAAGCAGCTTCTCATAATTGGTGGGCTGGACAGATACTTCCAAATAGCAAGATGCTATCGGGATGAGGGATCGAAGCCAGATCGTCAGCCTGAGTTCACACAGGTAGATATTGAGATGTCCTTTGTGGATCAGGCTGGTATCCAGAGTCTGGTGGAAGGAATGCTGCGTTTTTCTTGGCCAGAGGAGAAAGGACCCCTCCAAGCCCCATTCCCAGTTATGAGTTATGCAGATGCCATGAGCAGCTATGGGGTTGATAAGCCAGATACACGCTTTGAGATGAAGATCCAGGATGTGACAAGCCAGTTTAGGGAAGTGCAGCTGGGGTATGTGCAGGAAACTCTGAGAAAACCCCATGGATGTGTAAAAGCCATTTGCATTCCAGGAGGAGCTAAATTCATTAAAAGGAAAGAGCTGGATTCCATGCAAGAGCTTGTAAAGCAGCAGTATAACCAGGAAGTAGTGCCAGTTATCCTGAGGGCAGACAGTAGCTGGAAATCCCCTTTGGAGAAGTTTCTCAGTGCGAAGCTGAAGGAAAGCCTCACAGAAGCAATGGAAGCCAAGTCTGAGGACATTCTCTTGTTTGCAGCGGGGGAGCATATTCGAGCATGTTCTGCTTTGGGTAAGCTGCGACTGGATGCCGCCGCTCAGCTAGAAGAGTATGGGGTTCCTTTGCGGGACCCCACTGCCTTTCATTTCCTGTGGGTTGTAGACTTCCCACTCTTTCTCCCTAAAGAAGATAACGAGTTAGAGCTGGAATCTGCTCAC
  5   1   2      seed Gas7      out                        XZG50793.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGGAGAAAGGACCCCTCCAAGCCCCATTCCCAGTTATGAGTTATGCAGATGCCATGAGCAGCTATGGGGTTGATAAGCCAGATACACGCTTTGAGATGAAGATCCAGGATGTGACAAGCCAGTTTAGGGAAGTGCAGCTGGGGTATGTGCAGGAAACTCTGAGAAAACCCCATGGATGTGTAAAAGCCATTTGCATTCCAGGAGGAGCTAAATTCATTAAAAGGAAAGAGCTGGATTCCATGCAAGAGCTTGTAAAGCAGCAGTATAACCAGGAAGTAGTGCCAGTTATCCTGAGGGCAGACAGTAGCTGGAAATCCCCTTTGGAGAAGTTTCTCAGTGCGAAGCTGAAGGAAAGCCTCACAGAAGCAATGGAAGCCAAGTCTGAGGACATTCTCTTGTTTGCAGCGGGGGAGCATATTCGAGCATGTTCTGCTTTGGGTAAGCTGCGACTGGATGCCGCCGCTCAGCTAGAAGAGTATGGGGTTCCTTTGCGGGACCCCACTGCCTTTCATTTCCTGTGGGTTGTAGACTTCCCACTCTTTCTCCCTAAAGAAGATAACGAGTTAGAGCTGGAATCTGCTCACCACCCTTTCACTGCCCCTCATCCCGAGGACACTGCTCTTCTGCATACAGATCCAGCAAAGGTTCGAAGCCAACACTATGACCTGGTTTTGAATGGCAGTGAGGTTGGAGGGNGTTCAATTCGTATTCATAATTCANATTTGCAGCGCTGGGTCCTACAGGATGTATTANAGGAAGACGTGTCTCTTCTTTCTCACCTGC
  3   1   2       bld Gas7 PIPE in                         XZG38999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTGCAGCGGGGGAGCATATTCGAGCATGTTCTGCTTTGGGTAAGCTGCGACTGGATGCCGCCGCTCAGCTAGAAGAGTATGGGGTTCCTTTGCGGGACCCCACTGCCTTTCATTTCCTGTGGGTTGTAGACTTCCCACTCTTTCTCCCTAAAGAAGATAACGAGTTAGAGCTGGAATCTGCTCACCACCCTTTCACTGCCCCTCATCCCGAGGACACTGCTCTTCTGCATACAGATCCAGCAAAGGTTCGAAGCCAACACTATGACCTGGTTTTGAATGGCAGTGAGGTTGGAGGGGGTTCAATTCGTATTCATAATTCAAATTTGCAGCGCTGGGTCCTACAGGATGTATTAAAGGAAGACGTGTCTCTTCTTTCTCACCTGCTGGAGGCCCTGCAGTCAGGGGCACCCCCACATGGAGGCATTGCTTTAGGACTTGATCGGCTCATTGCAATTATTGTCGGAGCACCCAGCATTCGTGATGTCATTGCCTTTCCGAAATCATTCCGGGGACGTGACCTTATGAGTAATGCGCCCGACATGGTGTCTGCTGAGGATCTCCAGCAATATCACATTCAGGTGATTCCTCCATGTACTGAATCTAGTGGAAAATGAATGACCAACAACATGAATTCCATGAAGCTAAGGAAGTGAACACTAAGTTTACACTTGAAGCACTTCAGTTTCTCTGCCAAACTATTTTTGTGCTGCTCAAAAATTCATTAGACCGTAAATAATGGACTAGAATGTGTAAAAACTGCTAATGTCTTGAAAACCAGAAAAAAAAAAAAAAAGG
  5   1   2      skin Spl1      out                        CABK3188.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCGATTCGTTTCTCCCTGCTGGAGGCCCTGCAGTCAGGGGCACCCCCACATGGAGGCATTGCTTTAGGACTTGATCGGCTCATTGCAATTATTGTCGGAGCACCCAGCATTCGTGATGTCATTGCCTTTCCGAAATCATTCCGGGGACGTGACCTTATGAGTAATGCGCCCGACATGGTGTCTGCTGAGGATCTCCAGCAATATCACATTCAGGTGATCCCTCCATGTACTGAATCTAGTGGAAAATGAATGACCAACAACATGAATTCCATGAAGCTAAGGAAGTGAACACTAAGTTTACACTTGAAGCACTTCAGTTTCTCTGCCAAACTATTTTTGTGCTGCTCAAAAATTCATTAGACCGTAAATAATGGACTAGAATGTGTAAAAACTGCTAATGTCTTGAAAACCAGAAAAAAAAAAATCTAAATTGGGGGCTAATTTTCATTTAGATTTGTATGTTTACTTCTAATAAAGGGGTGGTTCACCTttaaagtgatactgacaccagaaaacactcttcaaaatataaatgtacattaaaagttacctataggtcatgctgatcgtttttcactgataggtttgctttagaagttcctaaacctgtcagtaatggattctaatgctaactgactcctgctgcacaaatatggcagccccctcatagagcatgggggatcagataggtaatgtaaaagcatctggcttttatgggaaaatgataaatagcatgcaaagacattgttaGATCGTGTCAGTATCTCTTAAAGTAACTTTTATCATGTTATAGAATAGCCAATTCTATGCAGCTTTTTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)