Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ12122.3                          21 END     1          50        4                (no blast hit)
     2   2.0    0Xt7.1-CABC6884.5                            9 END     1          50       11                l(3)mbt-like 2 isoform a [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012098814 Xt7.1-CAAK6186.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK6186.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCTTTCAATGGAAGGCGATTCAGAAGATGTTTATGATCTTTTCAGTGGCTATGACAGTTACAGAGAATATAGCAGTGGACTTAGTGATATCAGTTCTGGTCTTGGGGATTCAAGTTTAGATGAAGAGGAAAATGAAGGGTCTTCATCACTGCAGCAATCATCTTCTAGCGCTAACAAGGCCAATGAGGAGAATAGTGCTGAACCAGCTATTTGTGAGATGTGCGGGATTGTGGGCACACGTGGAACCTTCTTCTCCAAAACAAAGAGATTCTGTAATGTCTCCTGCTCACGTAGCTATTCCTCCAACTCCAAGAAAGCCAGTATTCTGGCCCGGCTGCAGGGCAAGCCACCGACAAGGAAAGCAAAAGTACTACATAAGGCATCCTGGTCTGCCAAAATAAAAGCTTTCCTGAATTCACAGAGCACGGGGCAGCCGGTTGACGGAACACCTACAGGGCAAGATGCTCTGGCTTTGGGCTTCGATTGGGGAAAATACATTACAGAAGGAAACTTTGAGGCTGCCCCTGTCACCTGCTTCAGACATGTTCCTCTCTGTGATCAGTGGGATGATATTGTAGAGGGGATTAAGGTAGAGAGTTTAAATACGGATGCTGTTCTTCCCAGTCGTGTCTATTGGATTTCTTCAGTTGTCAAGATAGCAGGTTACAAGGCTTTACTTCAGTATGAAGGTTTTGAAGAAGACTCGAGCCATAACTACTGGTGCAACTTGGGAACAGTGGAAATTCATCCCATTGGATGGTGTGCAGTAAACAGCAAAATATTGGTTCCACCCCAGTCCATCCTTTCAAAGTTTACAGACTGGAGAGAATACCTTATGAAGAAATTGGTCGGCTCCCATACCATACCTGCCGGATTTCATGTCAAG
                                                  Xt7.1-CHK-1008260038                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAATGGAAGGCGATTCAGAAGATGTTTATGATCTTTTCAGTGGCTATGACAGTTACAGAGAATATAGCAGTGGACTTAGTGATATCAGTTCTGGTCTTGGGGATTCAAGTTTAGATGAAGAGGAAAATGAAGGGTCTTCATCACTGCAGCAATCATCTTCTAGCGCTAACAAGGCCAATGAGGAGAATAGTGCTGAACCAGCTATTTGTGAGATGTGCGGGATTGTGGGCACACGTGGAACCTTCTTCTCCAAAACAAAGAGATTCTGTAATGTCTCCTGCTCACGTAGCTATTCCTCCAACTCCAAGAAAGCCAGTATTCTGGCCCGGCTGCAGGGCAAGCCACCGACAAGGAAAGCAAAAGTACTACATAAGGCATCCTGGTCTGCCAAAATAAAAGCTTTCCTGAATTCACAGAGCACGGGGCAGCCGGTTGACGGAACACCTACAGGGCAAGATGCTCTGGCTTTGGGCTTCGATTGGGGAAAATACATTACAGAAGGAAACTTTGAGGCTGCCCCTGTCACCTGCTTCAGACATGTTCCTCTCTGTGATCAGTGGGATGATATTGTAGAGGGGATTAAGGTAGAGAGTTTAAATACGGATGCTGTTCTTCCCAGTCGTGTCTATTGGATTTCTTCAGTTGTCAAGATAGCAGGTTACAAGGCTTTACTTCAGTATGAAGGTTTTGAAGAAGACTCGAGCCATAACTACTGGTGCAACTTGGGAACAGTGGAAATTCATCCCATTGGATGGTGTGCAGTAAACAGCAAAATATTGGTTCCACCCCAGTCCATCCTTTCAAAGTTTACAGACTGGAGAGAATACCTTATGAAGAAATTGGTCGGCTCCCATACCATACCTGCCGGATTTCAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 6e-011     FAA00089.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 3e-022     XP_001202275.1 PREDICTED: similar to KIAA1617 protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 1e-034     NP_723786.1 CG16975-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 5e-077     XP_696896.1 PREDICTED: similar to l(3)mbt-like 2 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ---- 9e-079     AAH75504.1 Mbt domain containing 1 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xl ---- 2e-079     AAH73284.1 LOC443638 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - ?? ---- 2e-079     NP_001085289.1 hypothetical protein LOC443638 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Hs ---- 2e-117     NP_113676.2 l(3)mbt-like 2 isoform a [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Mm ---- 3e-119     NP_666105.2 RIKEN cDNA 4732493N06 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Gg ---- 3e-120     NP_001006238.1 similar to l(3)mbt-like 2; H-l(3)mbt-like protein [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK6186.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2       bld Brn3      out                        CAAK6186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCTTTCAATGGAAGGCGATTCAGAAGATGTTTATGATCTTTTCAGTGGCTATGACAGTTACAGAGAATATAGCAGTGGACTTAGTGATATCAGTTCTGGTCTTGGGGATTCAAGTTTAGATGAAGAGGAAAATGAAGGGTCTTCATCACTGCAGCAATCATCTTCTAGCGCTAACAAGGCCAATGAGGAGAATAGTGCTGAACCAGCTATTTGTGAGATGTGCGGGATTGTGGGCACACGTGGAACCTTCTTCTCCAAAACAAAGAGATTCTGTAATGTCTCCTGCTCACGTAGCTATTCCTCCAACTCCAAGAAAGCCAGTATTCTGGCCCGGCTGCAGGGCAAGCCACCGACAAGGAAAGCAAAAGTACTACATAAGGCATCCTGGTCTGCCAAAATAAAAGCTTTCCTGAATTCACAGAGCACGGGGCAGCCGGTTGACGGAACACCTACAGGGCAAGATGCTCTGGCTTTGGGCTTCGATTGGGGAAAATACATTACAGAAGGAAACTTTGAGGCTGCCCCTGTCACCTGCTTCAGACATGTTCCTCTCTGTGATCAGTGGGATGATATTGTAGAGGGGATTAAGGTAGAGAGTTTAAATACGGATGCTGTTCTTCCCAGTCGTGTCTATTGGATTTCTTCAGTTGTCAAGATAGCAGGTTACAAGGCTTTACTTCAGTATGAAGGTTTTGAAGAAGACTCGAGCCATAACTACTGGTGCAACTTGGGAACAGTGGAAATTCATCCCATTGGATGCCATCCTTTCAAAGTTTACAGACTGGAGAGAATACCTTATGAAGAAAATGGTCGGCTCCCATACCATACCTGCGGATTTCCATGTNCAGATGGCAGAGAGCTTCAGATGCCCATTC
  5   1   2      seed Brn3      out                       CAAK12516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGATTCAGAAGATGTTTATGATCTTTTCAGTGGCTATGACAGTTACAGAGAATATAGCAGTGGACTTAGTGATATCAGTTCTGGTCTTGGGGATTCAAGTTTAGATGAAGAGGAAAATGAAGGGTCTTCATCACTGCAGCAATCATCTTCTAGCGCTAACAAGGCCAATGAGGAGAATAGTGCTGAACCAGCTATTTGTGAGATGTGCGGGATTGTGGGCACACGTGGAACCTTCTTCTCCAAAACAAAGAGATTCTGTAATGTCTCCTGCTCACGTAGCTATTCCTCCAACTCCAAGAAAGCCAGTATTCTGGCCCGGCTGCAGGGCAAGCCACCGACAAGGAAAGCAAAAGTACTACATAAGGCATCCTGGTCTGCCAAAATAAAAGCTTTCCTGAATTCACAGAGCACGGGGCAGCCGGTTGACGGAACACCTACAGGGCAAGATGCTCTGGCTTTGGGCTTCGATTGGGGAAAATACATTACAGAAGGAAACTTTGAGGCTGCCCCTGTCACCTGCTTCAGACATGTTCCTCTCTGTGATCAGTGGGATGATATTGTAGAGGGGATTAAGGTAGAGAGTTTAAATACGGATGCTGTTCTTCCCAGTCGTGTCTATTGGATTTCTTCAGTTGTCAAGATAGCAGGTTACAAGGCTTTACTTCAGTATGAAGGTTTTGAAGAAGACTCGAGCCATAACTACTGGTGCAACTTGGGAACAGTGGAAATTCATCCCATTGGATGGTGTGCAGTAAACAGCAAAATATTGGTTCCACCCCAGTCCATCCTTTCAAAGTTTACAGACTGGAGAGAATACCTTATGAAGAAATTGGTCGGCTCCCATACCATACCTGCCGGATTTCATGTCAAGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)