Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-TTpA066f11.5.5                       66 END     1          33        1                UPF3 regulator of nonsense transcripts homolog B isoform 2 [Homo sapiens]
     2   2.0    0Xt7.1-CAAJ13876.3                           6 END     2          66       33                (no blast hit)

 This cluster: approximate FL confidence score = 91%

 1012098852 Xt7.1-CAAJ13876.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ13876.5 ATTCTCCAGTCCCAGCTCAGTGAGGGAGGGACACCGAGAGCTGTCACACAGGGAGAGAGAGGGGGAGCCCAACCCAGGCAACTTGCACTGACTTACTGTGGGCAGGAGGCACATCCCAAGCTTCCACTGCAGCGGGGGGCACCCAGCACTGAGCAAAGAGCTGCAAGAGCAGGATGTGCCAGGTTCTGCCCTTCCCAGGGACCCCCGCACTGACCACTGACTGTCCCACAGGGGGGGCTCTGCTCCAACAATAACAACTTTGTGCCATGCATCATCGCCGAGAGTTTGGGACAGGAGAGCGGGCAAAGTTGTAGAAGGAGAATCGGCAGCAGAACGTGTCCCGGTCCGACAAGTGTCATGTCCCGGGAAGGAGGCGAGTGAAAGGGAGAGAGTGCAAGCCTGTAGGGATAGGAGCCCTCGGAGAGAAGTAGCCACTCGGGATTGTTCTGTGCCAGGAGCATCCGCTAACAGGTGAACTGAGCTGCGCGGAGGAGGGGGGGAGCCCTCACTGGGAGACATTGGGAAAGGGCTGAGCCTCCAAGGACAAAAGTGCATCTCAAGGGGGAAGCCTTGCCGGGCTGTTGCGGGGGAGGACTAGAGGAAACCCCAAACCTGTGGATAGCGGCGGGCAGGGGGGAAGTGATGGCCACGGCTGCCTCTAACCCCTACCTCGCTAGCAACAGCATCCTCTCCCCGGGATCCATCGTGCACTCAGACTCAGGGATTGGCATGCAGCCTGGAAGCGCCGCCGTTACCTCAGTGGCAGGCGGCTACCGGGGGGACCCCACGGTGAAGATGGTGCAGAGTGACTTCATGCAGGGGGCGATGGCTGCCAGTAATGGGGGGCACATGCTGAGCCACGCACACCAGTGGGTTACTGCCTTACCCCACGCAGCGGCAGCGGCGGCGGCAGCAGCTGCAGCAGCGGCAGAGGCAGGCTCTCCCTGGTCCAGCAGCCCGGTGGGCATGACCGGCAGCCCGCAGCATCCTCAGCAACAACAGCAGGACGTGAAAGGGGGAGCTGGGAGAGACGAACTGCACCCTGGGGCCGCCCTGCATCACCGGCCGCCTCACCTAGGACCCCATCAAGGGCATCCAGGAGGCTGGGGGGCGGCAGCCGCATCACACATCCAGTCAATGGCAGCGGGGACGCCGCAGCACCAGCAGCAACAACAACAGCAGCAGCAGCAGCAAGCTCTTCTGTACACCCAACCGGGGGCATTCACTGTGAACGGTATGCTAAGCCCACCCCCCGGGAGCCAAAACCTGGTACATCCAGGGCTG
                                                  Xt7.1-CHK-1008249615       CAGTCCCAGCTCAGTGAGGGAGGGACACCGAGAGCTGTCACACAGGGAGAGAGAGGGGGAGCCCAACCCAGGCAACTTGCACTGACTTACTGTGGGCAGGAGGCACATCCCAAGCTTCCACTGCAGCGGGGGGCACCCAGCACTGAGCAAAGAGCTGCAAGAGCAGGATGTGCCAGGTTCTGCCCTTCCCAGGGACCCCCGCACTGACCACTGACTGTCCCACAGGGGGGGCTCTGCTCCAACAATAACAACTTTGTGCCATGCATCATCGCCGAGAGTTTGGGACAGGAGAGCGGGCAAAGTTGTAGAAGGAGAATCGGCAGCAGAACGTGTCCCGGTCCGACAAGTGTCATGTCCCGGGAAGGAGGCGAGTGAAAGGGAGAGAGTGCAAGCCTGTAGGGATAGGAGCCCTCGGAGAGAAGTAGCCACTCGGGATTGTTCTGTGCCAGGAGCATCCGCTAACAGGTGAACTGAGCTGCGCGGAGGAGGGGGGGAGCCCTCACTGGGAGACATTGGGAAAGGGCTGAGCCTCCAAGGACAAAAGTGCATCTCAAGGGGGAAGCCTTGCCGGGCTGTTGCGGGGGAGGACTAGAGGAAACCCCAAACCTGTGGATAGCGGCGGGCAGGGGGGAAGTGATGGCCACGGCTGCCTCTAACCCCTACCTCGCTAGCAACAGCATCCTCTCCCCGGGATCCATCGTGCACTCAGACTCAGGGATTGGCATGCAGCCTGGAAGCGCCGCCGTTACCTCAGTGGCAGGCGGCTACCGGGGGGACCCCACGGTGAAGATGGTGCAGAGTGACTTCATGCAGGGGGCGATGGCTGCCAGTAATGGGGGGCACATGCTGAGCCACGCACACCAGTGGGTTACTGCCTTACCCCACGCAGCGGCAGCGGCGGCGGCAGCAGCTGCAGCAGCGGCAGAGGCAGGCTCTCCCTGGTCCAGCAGCCCGGTGGGCATGACCGGCAGCCCGCAGCATCCTCAGCAACAACAGCAGGACGTGAAAGGGGGAGCTGGGAGAGACGAACTGCACCCTGGGGCCGCCCTGCATCACCGGCCGCCTCACCTAGGACCCCATCAAGGGCATCCAGGAGGCTGGGGGGCGGCAGCCGCATCACACATCCAGTCAATGGCAGCGGGGACGCCGCAGCACCAGCAGCAACAACAACAGCAGCAGCAGCAGCAAGCTCTTCTGTACACCCAACCGGGGGCATTCACTGTGAACGGTATGCTAAGCCCACCCCCCGGGAGCCAAAACCTGGTACATCCA
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     642     291 
                                               BLH MIN     642      37 
                                               BLH MPR     633      37 
                                               BLH OVR     642     160 
                                               CDS MIN     642      37 
                                               ORF LNG     642       7 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Gg ---- 7e-007     NP_001026755.1 POU domain, class 3, transcription factor 2 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bf ---- 3e-012     AAL85498.1 transcription factor AmphiBrn1/2/4 [Branchiostoma floridae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 5e-020     AAI27329.1 Unknown (protein for MGC:146609) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 1e-023     CAA46047.1 POU domain protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 2e-078     NP_032926.2 POU domain, class 3, transcription factor 3 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 8e-079     NP_006227.1 POU domain, class 3, transcription factor 3 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 2e-090     NP_958855.1 POU domain gene 23 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ13876.5                                                                                                                                                                                                                   TGA------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TGA---------------------TAG---TAG------------------------------------------------------TAA---------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------ATG---------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2       bld HdA  5g3  out                  THdA032h21.p1kSP6 ATTCTCCAGTCCCAGCTCAGTGAGGGAGGGACACCGAGAGCTGTCACACAGGGAGAGAGAGGGGGAGCCCAACCCAGGCAACTTGCACTGACTTACTGTGGGCAGGAGGCACATCCCAAGCTTCCACTGCAGCGGGGGGCACCCAGCACTGAGCAAAGAGCTGCAAGAGCAGGATGTGCCAGGTTCTGCCCTTCCCAGGGACCCCCGCACTGACCACTGACTGTCCCACAGGGGGGGCTCTGCTCCAACAATAACAACTTTGTGCCATGCATCATCGCCGAGAGTTTGGGACAGGAGAGCGGGCAAAGTTGTAGAAGGAGAATCGGCAGCAGAACGTGTCCCGGTCCGACAAGTGTCATGTCCCGGGAAGGAGGCGAGTGAAAGGGAGAGAGTGCAAGCCTGTAGGGATAGGAGCCCTCGGAGAGAAGTAGCCACTCGGGATTGTTCTGTGCCAGGAGCATCCGCTAACAGGTGAACTGAGCTGCGCGGAGGAGGGGGGGAGCCCTCACTGGGAGACATTGGGAAAGGGCTGAGCCTCCAAGGACAAAAGTGCATCTCAAGGGGGAAGCCTTGCCGGGCTGTTGCGGGGGAGGACTANAGGAAACCCCANACCTGTGGATAGCGGCGGGCAGGGGGGAAGTGATGGCCACGGCTGCCTCTAACCCCTACCTCGCTAGCAACAGCATCCTCTCCCCGGGATCCATCGTGCACTCAGACTCAGGGATTGGCATGCAGCCTGGAAGCGCCGCCGTTACCTCANTGGCAGGCGGCTACCGGGGGG
  5   1   2   14 seed Brn2 5g3  out                       CAAJ13876.5p ...................................................................................................................................................................................CAGGTTCTGCCCTTCCCAGGGACCCCCGCACTGACCACTGACTGTCCCACAGGGGGGGCTCTGCTCCAACAATAACAACTTTGTGCCATGCATCATCGCCGAGAGTTTGGGACAGGAGAGCGGGCAAAGTTGTAGAAGGAGAATCGGCAGCAGAACGTGTCCCGGTCCGACAAGTGTCATGTCCCGGGAAGGAGGCGAGTGAAAGGGAGAGAGTGCAAGCCTGTAGGGATAGGAGCCCTCGGAGAGAAGTAGCCACTCGGGATTGTTCTGTGCCAGGAGCATCCGCTAACAGGTGAACTGAGCTGCGCGGAGGAGGGGGGGAGCCCTCACTGGGAGACATTGGGAAAGGGCTGAGCCTCCAAGGACAAAAGTGCATCTCAAGGGGGAAGCCTTGCCGGGCTGTTGCGGGGGAGGACTAGAGGAAACCCCAAACCTGTGGATAGCGGCGGGCAGGGGGGAAGTGATGGCCACGGCTGCCTCTAACCCCTACCTCGCTAGCAACAGCATCCTCTCCCCGGGATCCATCGTGCACTCAGACTCAGGGATTGGCATGCAGCCTGGAAGCGCCGCCGTTACCTCAGTGGCAGGCGGCTACCGGGGGGACCCCACGGTGAAGATGGTGCAGAGTGACTTCATGCAGGGGGCGATGGCTGCCAGTAATGGGGGGCACATGCTGAGCCACGCACACCAGTGGGTTACTGCCTTACCCCACGCAGCGGCAGCGGCGGCGGCAGCAGCTGCAGCAGCGGCAGAGGCAGGCTCTCCCTGGTCCAGCAGCCCGGTGGGCATGACCGGCAGCCCGCAGCATCCTCAGCAACAACAGCAGGACGTGAAAGGGGGAGCT
  5   1   2       bld HdA  5x3  out                  THdA024m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACAGAGGAACCCCAAACCTGTGGATAGCGGCGGGCAGGGGGGAAGTGATGGCCACGGCTGCCTCTAACCCCTACCTCGCTAGCAACAGCATCCTCTCCCCGGGATCCATCGTGCACTCAGACTCAGGGATTGGCATGCAGCCTGGAAGCGCCGCCGTTACCTCAGTGGCAGGCGGCTACCGGGGGGACCCCACGGTGAAGATGGTGCAGAGTGACTTCATGCAGGGGGCGATGGCTGCCAGTAATGGGGGGCACATGCTGAGCCACGCACACCAGTGGGTTACTGCCTTACCCCACGCAGCGGCAGCGGCGGCGGCAGCAGCTGCAGCAGCGGCAGAGGCAGGCTCTCCCTGGTCCAGCAGCCCGGTGGGCATGACCGGCAGCCCGCAGCATCCTCAGCAACAACAGCAGGACGTGAAAGGGGGAGCTGGGAGAGACGAACTGCACCCTGGGGCCGCCCTGCATCACCGGCCGCCTCACCTAGGACCCCATCAAGGGCATCCAGGAGGCTGGGGGGCGGCAGCCGCATCACACATCCAGTCAATGGCAGCGGGGACGCCGCAGCACCAGCAGCAACAACAACAGCAGCAGCAGCAGCAAGCTCTTCTGTACACCCAACCGGGGGCATTCACTGTGAACGGTATGCTAAGCCCACCCCCCGGGAGCCAAAACCTGGTACATCCAGGGCTGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)