Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK8759.3                            5 END     1          50       20                calcium channel, alpha 1A subunit isoform 2 [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012099237 Xt7.1-CAAJ15373.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ15373.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAGACAGGCAGACCTCGTCATGGTAGGGATGGAATGAGGGTACGAGAAGGGGGTGGAGGAGAAAGTGAGGGTCCTGAGGGTGAGAGGAGGAGGAGGCATCGACACGCGGCACAGTCCACTTACGAGAGCGATGCCAAGAGGGATGACAGAGAGAGGAGGCATCGCAGAAGGAAGGAACCCACAGCCCCAACCCCAGGCTCTGGTGGGCCAAATCTTTCCACAACGCGACCTATTCAAGACCGTTCCCGGCAGGAGAACCAGAACCAGCAGCCTGAAAACATGGATAACATTCGTAACACCAAACTTGTGACCAGTGAGCCGCCCGCAGGTGGTGGTGTGGGTGGTCTCAATCACAGCCCAGCCAAAATCGGTAACCACACCAATTGTGCCAACAACAACAGTGTGCCCACTGGAAATGCCACCCCCAGACGGACGCCTCATCCAACCAATTCAGGCCCTCCTCCTTCTGCTCCTGACCCCAGCCACACCTTTAGCAACCCTACAGAGACTGCCAAGGGGACGAAAACCACAGAACACACAACTGTGGATATTCCACCCCCATTCCCTCCACCTGTGGAGAATGCTATTGGGCAAGCCAATAAGATTGTTGCAGTCTCCCCGCTTCCTAAAAAAGACGATGAGAAAAAAGAAGAAGAGGAGGATGATGATGATGGAGAAAAGGGCCCTAAGCCGATGCCCCCCTACAGCTCCATGTTTATTTTGTCTACTACTAACCCTCTTCGGCGACTGTGCCATTACATAGTCACTATGCGATACTTTGAAATGTGCATCTTGATGGTGATCGCAATGAGCAGTATAGCCCTC
                                                  Xt7.1-CHK-1008251919                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGGCAGACCTCGTCATGGTAGGGATGGAATGAGGGTACGAGAAGGGGGTGGAGGAGAAAGTGAGGGTCCTGAGGGTGAGAGGAGGAGGAGGCATCGACACGCGGCACAGTCCACTTACGAGAGCGATGCCAAGAGGGATGACAGAGAGAGGAGGCATCGCAGAAGGAAGGAACCCACAGCCCCAACCCCAGGCTCTGGTGGGCCAAATCTTTCCACAACGCGACCTATTCAAGACCGTTCCCGGCAGGAGAACCAGAACCAGCAGCCTGAAAACATGGATAACATTCGTAACACCAAACTTGTGACCAGTGAGCCGCCCGCAGGTGGTGGTGTGGGTGGTCTCAATCACAGCCCAGCCAAAATCGGTAACCACACCAATTGTGCCAACAACAACAGTGTGCCCACTGGAAATGCCACCCCCAGACGGACGCCTCATCCAACCAATTCAGGCCCTCCTCCTTCTGCTCCTGACCCCAGCCACACCTTTAGCAACCCTACAGAGACTGCCAAGGGGACGAAAACCACAGAACACACAACTGTGGATATTCCACCCCCATTCCCTCCACCTGTGGAGAATGCTATTGGGCAAGCCAATAAGATTGTTGCAGTCTCCCCGCTTCCTAAAAAAGACGATGAGAAAAAAGAAGAAGAGGAGGATGATGATGATGGAGAAAAGGGCCCTAAGCCGATGCCCCCCTACAGCTCCATGTTTATTTTGTCTACTACTAACCCTCTTCGGCGACTGTGCCATTACATAGTCACTATGCGATACTTTGAAATGTGCATCTTGATGGTGATCGCAATGAGCAGTATAGCCCTCGCTGCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 4e-007     CAJ83937.1 serine/arginine repetitive matrix 1 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                          PROTEIN --- Xl ---- 1e-007     AAH82855.1 LOC494754 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 7e-013     NP_741734.1 UNCoordinated locomotion UNC-2, voltage-gated Calcium Channel Alpha subunit (unc-2) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 6e-017     XP_001186699.1 PREDICTED: similar to voltage-dependent non-L-type calcium channel alpha-1 subunit [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-017     NP_996417.1 CG1522-PE, isoform E [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Dr ---- 4e-018     XP_683694.1 PREDICTED: similar to voltage-gated calcium channel subunit Cav2.2 variant I [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-024     NP_989624.1 calcium channel, voltage-dependent, L type, alpha 1B subunit [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-044     XP_690548.1 PREDICTED: similar to Voltage-dependent P/Q-type calcium channel alpha-1A subunit (Voltage-gated calcium channel alpha subunit Cav2.1) (Calcium channel, L type, alpha-1 polypeptide, isoform 4) (Brain calcium channel I) (BI) (RAT brain class A) (RBA-I)... [ -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 5e-066     NP_031604.3 calcium channel, voltage-dependent, P/Q type, alpha 1A subunit [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 7e-079     NP_075461.1 calcium channel, alpha 1A subunit isoform 2 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ15373.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------ATG------------ATG---------ATG---------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       bld Te3                                  CAAM7892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAGACAGGCAGACCTCGTCATGGTAGGGATGGAATGAGGGTACGAGAAGGGGGTGGAGGAGAAAGTGAGGGTCCTGAGGGTGAGAGGAGGAGGAGGCATCGACACGCGGCACAGTCCACTTACGAGAGCGATGCCAAGAGGGATGACAGAGAGAGGAGGCATCGCAGAAGGAAGGAACCCACAGCCCCAACCCCAGGCTCTGGTGGGCCAAATCTTTCCACAACGCGACCTATTCAAGACCGTTCCCGGCAGGAGAACCAGAACCAGCAGCCTGAAAACATGGATAACATTCGTAACACCAAACTTGTGACCAGTGAGCCGCCCGCAGGTGGTGGTGTGGGTGGTCTCAATCACAGCCCAGCCAAAATCGGTAACCACACCAATTGTGCCAACAACAACAGTGTGCCCACTGGAAATGCCACCCCCAGACGGACGCCTCATCCAACCAATTCAGGCCCTCCTCCTTCTGCTCCTGACCCCAGCCACACCTTTAGCAACCCTACAGAGACTGCCAAGGGGACGAAAACCACAGAACACACAACTGTGGATATTCCACCCCCATTCCCTCCACCTGTGGAGAATGCTATTGGGCAAGCCAATAAGATTGTTGCAGTCTCCCCGCTTCCTAAAAAAGACGATGAGAAAAAAGAAGAAGAGGAGGATGATGATGATGGAGAANAGGGCCCTAAGCCGATGCCCCCCTACAGCTCCATGTTTATTTTGTCTACTACTAACCCTCTTCGGCGACTGTGCCATTACATAGTCACTATGCGATACTTTGAAATGTGCATCTTGATGGTGATCGCAATGAGCAGTATAGCCCTCGCTGCTG
  5   1   2      seed Brn2      out                       CAAJ15373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGACCTCGTCATGGTAGGGATGGAATGAGGGTACGAGAAGGGGGTGGAGGAGAAAGTGAGGGTCCTGAGGGTGAGAGGAGGAGGAGGCATCGACACGCGGCACAGTCCACTTACGAGAGCGATGCCAAGAGGGATGACAGAGAGAGGAGGCATCGCAGAAGGAAGGAACCCACAGCCCCAACCCCAGGCTCTGGTGGGCCAAATCTTTCCACAACGCGACCTATTCAAGACCGTTCCCGGCAGGAGAACCAGAACCAGCAGCCTGAAAACATGGATAACATTCGTAACACCAAACTTGTGACCAGTGAGCCGCCCGCAGGTGGTGGTGTGGGTGGTCTCAATCACAGCCCAGCCAAAATCGGTAACCACACCAATTGTGCCAACAACAACAGTGTGCCCACTGGAAATGCCACCCCCAGACGGACGCCTCATCCAACCAATTCAGGCCCTCCTCCTTCTGCTCCTGACCCCAGCCACACCTTTAGCAACCCTACAGAGACTGCCAAGGGGACGAAAACCACAGAACACACAACTGTGGATATTCCACCCCCATTCCCTCCACCTGTGGAGAATGCTATTGGGCAAGCCAATAAGATTGTTGCAGTCTCCCCGCTTCCTAAAAAAGACGATGAGAAAAAAGAAGAAGAGGAGGATGATGATGATGGAGAAAAGGGCCCTAAGCCGATGCCCCCCTACAGCTCCATGTTTATTTTGTCTACTACTAACCCTCTTCGGCGACTGTGCCATTACATAGTCACTATGCGATACTTTGAAATGTGCATCTTGATGGTGATCGCAATGAGCAGTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)