Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1  1.75    0Xt7.1-XZT26214.3                            5 END     4         100       80                GABA-A receptor a6 subunit [Gallus gallus]

 This cluster: approximate FL confidence score = 79%

 1012099247 Xt7.1-XZT26214.5 - 4 ESTs
                                                                       ...-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT26214.5                                                      GTGATAGAGAAATCAAAGAGCAAAAACAGAAGAAAAAACAAAACACATTGTCTGTGCTACTCGAACTTGTATCGATATCCAGATGGGGAACTGAGGAAAATCATGGCATCTGTAACTCTCCTTGGTTGACTGAGCAAAGCGACTCTTTTTTGTTTTGTCTTGGAAACTTTCAGTTGCAGTGGTATCATGGCATCTTTTATTATGTGGATATACATATTCCTATGCAAAAGCACTAGGAAACAATATCACTGCTGCAAATCTGCATTCTGAAAATATAACCCGGATACTTGATAGGCTGCTGGACGGTTATGACAACAGACTCCGACCTAGCTTTGGAGGTCCCGTGACTGAAGTCAAAACAGACATATATGTGACCAGTTTTGGCCCTGTATCAGATGTCGATATGGAATATACAATGGACATATTTTTTCGCCAGACATGGGTTGATGAACGACTCAAATTTGATGGACCAACAGAAATACTTAGGTTGAACAACTTAATGGTCAGTAAAATCTGGACTCCAGACACTTTTTTCAGGAATGGCAAAAAGTCTATTGCTCACAATATGACAACCCCCAATAAACTCTTTCGGATCATGCAGAATGGAACAGTGCTCTACACAATGAGGTTGACAATAAAAGCTGAGTGCCCAATGAGACTAATGAATTTCCCAATGGATGGACATGCCTGCCCTCTAAAGTTTGGGAGCTATGCCTATCCAAAAAGCGAAATAGTCTACACTTGGAAAAAAGGACCATTGTATTCTGTTGAGGTACCAGAGGAATCTTCAAGTCTCCTCCAGTATGATCTAGTTGGACAAAAAGTTTCAAGTGAGACACTGTTATCAAATACAGGTGAATATTCACTACAAGTAGTCATGTTTTTCCTTCAGAGGAAAATAGGGATACTATATCATTCATACATACATCCCATGCAGCATGACTGTTGTTCTGTCTCAAGTTGTCTTTTGGATCAACAAAGAAT
                                                  Xt7.1-CHK-1008246552                                                            GAGAAATCAAAGAGCAAAAACAGAAGAAAAAACAAAACACATTGTCTGTGCTACTCGAACTTGTATCGATATCCAGATGGGGAACTGAGGAAAATCATGGCATCTGTAACTCTCCTTGGTTGACTGAGCAAAGCGACTCTTTTTTGTTTTGTCTTGGAAACTTTCAGTTGCAGTGGTATCATGGCATCTTTTATTATGTGGATATACATATTCCTATGCAAAAGCACTAGGAAACAATATCACTGCTGCAAATCTGCATTCTGAAAATATAACCCGGATACTTGATAGGCTGCTGGACGGTTATGACAACAGACTCCGACCTAGCTTTGGAGGTCCCGTGACTGAAGTCAAAACAGACATATATGTGACCAGTTTTGGCCCTGTATCAGATGTCGATATGGAATATACAATGGACATATTTTTTCGCCAGACATGGGTTGATGAACGACTCAAATTTGATGGACCAACAGAAATACTTAGGTTGAACAACTTAATGGTCAGTAAAATCTGGACTCCAGACACTTTTTTCAGGAATGGCAAAAAGTCTATTGCTCACAATATGACAACCCCCAATAAACTCTTTCGGATCATGCAGAATGGAACAGTGCTCTACACAATGAGGTTGACAATAAAAGCTGAGTGCCCAATGAGACTAATGAATTTCCCAATGGATGGACATGCCTGCCCTCTAAAGTTTGGGAGCTATGCCTATCCAAAAAGCGAAATAGTCTACACTTGGAAAAAAGGACCATTGTATTCTGTTGAGGTACCAGAGGAATCTTCAAGTCTCCTCCAGTATGATCTAGTTGGACAAAAAGTTTCAAGTGAGACACTGTTATCAAATACAGGTGAATATTCACTACAAGTAGTCATGTTTTTCCTTCAGAGGAAAATAGGGATACTATATCATTCATACATACATCCCATGCAGCATGACTGTTGTTCTGTCTCAAGTTGTCTTTTGGATCAACAAAGAATCAGTTC
                                                      consensus depths                                                           1     1     1     2     1     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     2     1     2     1     2     1     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     217      89                                                      
                                               BLH OVR     403      55                                                      
                                               ORF LNG     403       6                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 1e-026     XP_783809.2 PREDICTED: similar to gamma-aminobutyric acid A receptor beta 2S chain precursor - chicken [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 3e-047     NP_498532.3 F11H8.2 [Caenorhabditis elegans] -----------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 4e-055     NP_524131.1 CG7446-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Xt ---- 2e-070     AAI18789.1 Unknown (protein for IMAGE:7671326) [Xenopus tropicalis] ------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Xl ---- 2e-091     AAH79777.1 MGC86282 protein [Xenopus laevis] -----------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PREDICTED - ?? ---- 1e-090     XP_702341.1 PREDICTED: hypothetical protein XP_697249 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 4e-104     NP_001017822.1 hypothetical protein LOC550520 [Danio rerio] -----------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 5e-104     NP_034381.1 gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 4 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 2e-119     NP_000802.1 gamma-aminobutyric acid A receptor, alpha 6 precursor [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Gg ---- 1e-121     NP_990389.1 GABA-A receptor a6 subunit [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT26214.5                                                       TGATAG---------------------------------------------------------------------------ATG------TGA------------------TAA---------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------ATG------------------------ATG---------------------------ATG------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2   12  bld Tad5 5g3  out                        XZT26214.5p .....................................................GTGATAGAGAAATCAAAGAGCAAAAACAGAAGAAAAAACAAAACACATTGTCTGTGCTACTCGAACTTGTATCGATATCCAGATGGGGAACTGAGGAAAATCATGGCATCTGTAACTCTCCTTGGTTGACTGAGCAAAGCGACTCTTTTTTGTTTTGTCTTGGAAACTTTCAGTTGCAGTGGTATCATGGCATCTTTTATTATGTGGATATACATATTCCTATGCAAAAGCACTAGGAAACAATATCACTGCTGCAAATCTGCATTCTGAAAATATAACCCGGATACTTGATAGGCTGCTGGACGGTTATGACAACAGACTCCGACCTAGCTTTGGAGGTCCCGTGACTGAAGTCAAAACAGACATATATGTGACCAGTTTTGGCCCTGTATCAGATGTCGATATGGAATATACAATGGACATATTTTTTCGCCAGACATGGGTTGATGAACGACTCAAATTTGATGGACCAACAGAAATACTTAGGTTGAACAACTTAATGGTCAGTAAAATCTGGACTCCAGACACTTTTTTCAGGAATGGCAAAAAGTCTATTGCTCACAATATGACAACCCCCAATAAACTCTTTCGGATCATGCAGAATGGAACAGTGCTCTACACAATGAGGTTGACAATAAAAGCTGAGTGCCCAATGAGACTAATGAATTTCCCAATGGATGGACATGCCTGCCCTCTAAAGTTTGGGAGCTATGCCTATCCAAAAAGCGAAATAGTCTACACTTGGAAAAAAGGACCATTGTATTCTGTTGAGGTACCAGAGGAAATCTCAAGTCTCCTCCAGTATGATCTAGTTGGACAAAAAGTTTCAAGTGAGACACTGTTATCAAATACAGGTGAATATTCACTACNAGTAGTCATG
  5   1   1       add Eye       out                        CCAX9841.b1                                                             GAGAAATCAAAGAGCAAAAACAGAAGAAAAACAAAACACATTGTCTGTGCTACTCGAACTTGTATCGATATCCAGATGGGGAACTGAGGAAAATCATGGCATCTGTAACTCTCCTTGGTTGACTGAGCAAAGCGAACTCTTTTTTTTGTTTTTGTCTTGGAAACCTTTTCAGT
  5   1   2   10  bld Eye  5g3  out                        CCAX4924.b1 ...........................................................................................................CTCGAACTTGTATCGATATCCAGATGGGGAACTGAGGAAAATCATGGCATCTGTAACTCTCCTTGGTTGACTGAGCAAAGCGACTCTTTTTTGTTTTGTCTTGGAAACTTTCAGTTGCAGTGGTATCATGGCATCTTTTATTATGTGGATATACATATTCCTATGTACAGCAAAAGCACTAGGAAACAATATCACTGCTGCAAATCTGCATTCTGAAAATATAACCCGGATACTTGATAGGCTGCTGGACGGTTATGACAACAGACTCCGACCTAGCTTTGGAGGTCCCGTGACTGAAGTCAAAACAGACATATATGTGACCAGTTTTGGCCCTGTATCAGATGTCGATATGGAATATACAATGGACATATTTTTTCGCCAGACATGGGTTGATGAACGACTCAAATTTGATGGACCAACAGAAATACTTAGGTTGAACAACTTAATGGTCAGTAAAATCTGGACTCCAGACACTTTTTTCAGGAATGGCAAAAAGTCTATTGCTCACAATATGACAACCCCCAATAAACTCTTTCGGATCATGCAGAATGGAACAGTGCTCTACACAATGAGGTTGACAATAAAAGCTGAGTGCCCAATGAGACTAATGAATTTCCCAATGGATGGACATGCCTGCCCTCTAAAGTTTGGGAGCTATGCCTATCCAAAAGCGAAATAGTCTACACTTGGAAAAAGGACCATTGTATTCTGTTGAGGTACCAGAGGAATCTTCAAGTCTCCTCCAGTATGATCTAGTTGGACAAAAAGTTTCAA
  5   1   2   10 seed Eye  5g3  out                        CCAX8756.b1 ...........................................................................................................................................................................................................................................................................................................CACTGCTGCAAATCTGCATTCTGAAAATATAACCCGGATACTTGATAGGCTGCTGGACGGTTATGACAACAGACTCCGACCTAGCTTTGGAGGTCCCGTGACTGAAGTCAAAACAGACATATATGTGACCAGTTTTGGCCCTGTATCAGATGTCGATATGGAATATACAATGGACATATTTTTTCGCCAGACATGGGTTGATGAACGACTCAAATTTGATGGACCAACAGAAATACTTAGGTTGAACAACTTAATGGTCAGTAAAATCTGGACTCCAGACACTTTTTTCAGGAATGGCAAAAAGTCTATTGCTCACAATATGACAACCCCCAATAAACTCTTTCGGATCATGCAGAATGGAACAGTGCTCTACACAATGAGGTTGACAATAAAAGCTGAGTGCCCAATGAGACTAATGAATTTCCCAATGGATGGACATGCCTGCCCTCTAAAGTTTGGGAGCTATGCCTATCCAAAAAGCGAAATAGTCTACACTTGGAAAAAAGGACCATTGTATTCTGTTGAGGTACCAGAGGAATCTTCAAGTCTCCTCCAGTATGATCTAGTTGGACAAAAAGTTTCAAGTGAGACACTGTTATCAAATACAGGTGAATATTCACTACAAGTAGTCATGTTTTTCCTTCAGAGGAAAATAGGGATACTATATCATTCATACATACATCCCATGCAGCATGACTGTTGTTCTGTCTCAAGTTGTCTTTTGGATCAACAAAGAATCAGTTCCAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)