Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAL11251.3                           3 END     2         100       66                (no blast hit)

 This cluster: approximate FL confidence score = 72%

 1012099632 Xt7.1-CAAQ6022.3 - 2 ESTs
                                                                       ..-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAQ6022.3                                                                                                                                                                                                 ATCTGCATCTGACATGGCTGACACCAAGTGATGCTGGCTCTGTTTGGGAATACAAAGACAGGGGCAGGGGACCACTGAGAGGAAGCAGCTGATTTGAAACAGTGGAGCTGCTGATACTAAATCAACATGAGTAGTGAACTTAACATTCCAGTGGACCCTTCCACCCCTGCTGTCTCTGAGAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTAGTCACATCCAACCACCATTCTGTCCAGGCTCTTTCATGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGCCGCACCTCAGCATTGCTGTCTGGATTTGCTATGGTTGCAATGGTTGAAGTCCAGCTTGAGATGAAATATGGATACCCACAGCTGCTGCTGATAGCATTTAGTGCTTGCACAACAGTGCTTGTTGCAGTCCACCTATTTGCCCTCCTGATCAGCACATGCATCCTGCCCAATGTAGAAGCTGTGAGTAACATTCATAATCTGAACTCTGTCAATGAATCCCCACATGATCGTATGCATCCCTACATTGAGTTGGCCTGGGGATTTTCCACAGCTCTTGGGATCCTTCTTTTTCTTGCAGAAGTTGTTCTTTTGTGCTGGATAAAATTTCTACCCATAGACTCTGCATCAACACGAAATGAAACCACTGCAACTCAAAAGCCGCGTGGAAATGCAGGGTGGAACTCTGCACTGATTTCAACCATTATTATGGTGCCTGTTGGAATCATCTTTGTTATCTTTACTATTCATTTCTATCGTACTCTAGTGAGGCATAAAACAGAGCGTCATCATCAAGAAATAGAGGAACTCCATAAATTGAAAGTACAACTTGATGGACATGATCGGGGCATAAATGTAGTGTAAGTAAGTTAGAGCAGAGATGCACTGCGAGTTCACACCTATCAGAGACATAAAACTGAGGTGTAAGACCTTTGGTCAGAAATGTGCACAGTGCAGCCCGTTTTTACTCGCTGAGAAAGGGCAAGAATCAAAACAAATGACCCTATATTTTACAGTGCCTCTATGACTAGTTTATTTACTTTG
                                                  Xt7.1-CHK-1008255501                                                                                                                                                                                                       ATCTGACATGGCTGACACCAAGTGATGCTGGCTCTGTTTGGGAATACAAAGACAGGGGCAGGGGACCACTGAGAGGAAGCAGCTGATTTGAAACAGTGGAGCTGCTGATACTAAATCAACATGAGTAGTGAACTTAACATTCCAGTGGACCCTTCCACCCCTGCTGTCTCTGAGAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTAGTCACATCCAACCACCATTCTGTCCAGGCTCTTTCATGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGCCGCACCTCAGCATTGCTGTCTGGATTTGCTATGGTTGCAATGGTTGAAGTCCAGCTTGAGATGAAATATGGATACCCACAGCTGCTGCTGATAGCATTTAGTGCTTGCACAACAGTGCTTGTTGCAGTCCACCTATTTGCCCTCCTGATCAGCACATGCATCCTGCCCAATGTAGAAGCTGTGAGTAACATTCATAATCTGAACTCTGTCAATGAATCCCCACATGATCGTATGCATCCCTACATTGAGTTGGCCTGGGGATTTTCCACAGCTCTTGGGATCCTTCTTTTTCTTGCAGAAGTTGTTCTTTTGTGCTGGATAAAATTTCTACCCATAGACTCTGCATCAACACGAAATGAAACCACTGCAACTCAAAAGCCGCGTGGAAATGCAGGGTGGAACTCTGCACTGATTTCAACCATTATTATGGTGCCTGTTGGAATCATCTTTGTTATCTTTACTATTCATTTCTATCGTACTCTAGTGAGGCATAAAACAGAGCGTCATCATCAAGAAATAGAGGAACTCCATAAATTGAAAGTACAACTTGATGGACATGATCGGGGCATAAATGTAGTGTAAGTAAGTTAGAGCAGAGATGCACTGCGAGTTCACACCTATCAGAGACATAAAACTGAGGTGTAAGACCTTTGGTCAGAAATGTGCACAGTGCAGCCCGTTTTTACTCGCTGAGAAAGGGCAAGAATCAAAACAAATGACCCTATATTTTACAGTGCCTCTATGACTAGTTTATTT
                                                      consensus depths                                                                                                                                                                                                      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     126     162                                                                                                                                                                                                 
                                               BLH MIN      48     110                                                                                                                                                                                                 
                                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-031     NP_497231.1 CAP-binding protein complex interacting 2 like (32.0 kD) (3B271) [Caenorhabditiselegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 6e-058     NP_611273.1 CG11430-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 1e-058     XP_780791.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 4e-116     XP_706744.1 PREDICTED: similar to CG11430-PB, isoform B isoform 2 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 2e-119     NP_848866.2 transmembrane protein 142B [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Hs ==== 7e-120     NP_116220.1 hypothetical protein LOC80228 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 2e-128     NP_001025881.1 hypothetical protein LOC417509 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 8e-144     AAH66119.1 MGC68830 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = ?? ==== 8e-144     NP_001084444.1 hypothetical protein LOC403390 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 1e-145     AAI36156.1 Unknown (protein for MGC:122918) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAQ6022.3                                                                                                                                                                                                          TGA------TGA---------ATG------------------------------------------TGA---------------------------------TGA---TAA------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TAA------TAG---------------------------------------------------TAA---------------ATG---------------------------TGA------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  0   1   1           Brn4 FL                         CAAL11251.FL-MGC                                                                                                                                                                                                 ATCTGCATCTGACATGGCTGACACCAAGTGATGCTGGCTCTGTTTGGGAATACAAAGACAGGGGCAGGGGACCACTGAGAGGAAGCAGCTGATTTGAAACAGTGGAGCTGCTGATACTAAATCAACATGAGTAGTGAACTTAACATTCCAGTGGACCCTTCCACCCCTGCTGTCTCTGAGAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTAGTCACATCCAACCACCATTCTGTCCAGGCTCTTTCATGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGCCGCACCTCAGCATTGCTGTCTGGATTTGCTATGGTTGCAATGGTTGAAGTCCAGCTTGAGATGAAATATGGATACCCACAGCTGCTGCTGATAGCATTTAGTGCTTGCACAACAGTGCTTGTTGCAGTCCACCTATTTGCCCTCCTGATCAGCACATGCATCCTGCCCAATGTAGAAGCTGTGAGTAACATTCATAATCTGAACTCTGTCAATGAATCCCCACATGATCGTATGCATCCCTACATTGAGTTGGCCTGGGGATTTTCCACAGCTCTTGGGATCCTTCTTTTTCTTGCAGAAGTTGTTCTTTTGTGCTGGATAAAATTTCTACCCATAGACTCTGCATCAACACGAAATGAAACCACTGCAACTCAAAAGCCGCGTGGAAATGCAGGGTGGAACTCTGCACTGATTTCAACCATTATTATGGTGCCTGTTGGAATCATCTTTGTTATCTTTACTATTCATTTCTATCGTACTCTAGTGAGGCATAAAACAGAGCGTCATCATCAAGAAATAGAGGAACTCCATAAATTGAAAGTACAACTTGATGGACATGATCGGGGCATAAATGTAGTGTAAGTAAGTTAGAGCAGAGATGCACTGCGAGTTCACACCTATCAGAGACATAAAACTGAGGTGTAAGACCTTTGGTCAGAAATGTTGCACAGTGCAGCCCGTTTTTACTCGCTGAGAAAGGCAAAGAATCAAAAACAAATGACCTAATATTTTACAGTGCCTCTATGACTAGTTTATTTTACTTGGCCATTTATATAGCTAGGCCTTGACTTTGTTGTTATGTTTCTTTTTGACAGGTAACTGAAAGGGAAATACATTTATAAAGAAAACAGCAACATCTTAACTAGGATCCAAGGGGAGTTTTTATTCCTTACAGACCGGTACCGTTTTAACTCCCACTGTAAATATAGTTCCAGGGACTTGTACAGCTGAACAAACACTTATGGTTTACAGCTTCTGTAGCATAAAAGGGATTTTTGGAAAGAAGGGAGTATTTGTAACCAGCATGGGATGAACTTGATATTTGGACATTAATTTGTTGCAAATAACATTAGGAACATCTATTGGCAAAATTCAGCACTCTGCCACTGGTGGAAATTATACTCCCAGCATGCCCTGTTCACTAAGCTGGCTTGGAACCACCTGCAGTGCTTATGTTTTCCTACCCCATGTAGGTTCATGCGTGGAGCATTATCTGAAAAACCCTTTCAATGAACTTGTATAGAATTATGAGAATGTTTTATCTGCTCTTCTTAGTTTACATTAATATTTATTTGGTATATTTTTTGCATGGGTTTTCAACCCACTCTTGTACCGGAAAGGGGAATTAGTGGCCAAATTGTTTTCTGCAAAGTTGCATTAACAGAGATTAACTACAATTGTAGTTTGTGTAAATAAATGATCAGAATTTGTTTTTTTTGTGCCAGAGGAAAAGCTGGGGGAGGGGGGATTTTTTGAATTGGGATTCCTAGCAATGCCCTGGCATTTTGACAGCAGTTTGAATTTTATTACAATTTTTTTCCCTGATGTTATGAAGATTTGTTACCAATTCGTGTTAATTTATCAAAGCATTAAACTCTTTCTCTTACTGGCTTAAAAAAAAAAAAAAAAA
  5   1   2      seed Brn4 FL   out                       CAAL11251.5p                                                                                                                                                                                                 ATCTGCATCTGACATGGCTGACACCAAGTGATGCTGGCTCTGTTTGGGAATACAAAGACAGGGGCAGGGGACCACTGAGAGGAAGCAGCTGATTTGAAACAGTGGAGCTGCTGATACTAAATCAACATGAGTAGTGAACTTAACATTCCAGTGGACCCTTCCACCCCTGCTGTCTCTGAGAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTAGTCACATCCAACCACCATTCTGTCCAGGCTCTTTCATGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGCCGCACCTCAGCATTGCTGTCTGGATTTGCTATGGTTGCAATGGTTGAAGTCCAGCTTGAGATGAAATATGGATACCCACAGCTGCTGCTGATAGCATTTAGTGCTTGCACAACAGTGCTTGTTGCAGTCCACCTATTTGCCCTCCTGATCAGCACATGCATCCTGCCCAATGTAGAAGCTGTGAGTAACATTCATAATCTGAACTCTGTCAATGAATCCCCACATGATCGTATGCATCCCTACATTGAGTTGGCCTGGGGATTTTCCACAGCTCTTGGGATCCTTCTTTTTCTTGCAGAAGTTGTTCTTTTGTGCTGGATAAAATTTCTACCCATAGACTCTGCATCAACACGAAATGAAACCACTGCAACTCAAAAGCCGCGTGGAAATGCAGGGTGGAACTCTGCACTGATTTCAACCATTATTATGGTGCCTGTTGGAATCATCTTTGTTATCTTTACTATTCATTTCTATCGTACTCTAGTGAGGCATAAAACAGAGCGTCATCATCAAGAAATAGAGGAA
  3  -1   2       bld Hrt1      out                        CAAQ6022.3p                                                                                                                                                                                                                                                                                                                                              AACATTCCAGTGGACCCTTCCACCCCTGCTGTCTCTGAGAGAGGAAACAAAGGCATGGACTACAGAGACTGGGTCAGACGTAGCTACCTTGAACTAGTCACATCCAACCACCATTCTGTCCAGGCTCTTTCATGGAGGAAGTTGTACCTCAGCAGAGCCAAGTTAAAGGCCTCCAGCCGCACCTCAGCATTGCTGTCTGGATTTGCTATGGTTGCAATGGTTGAAGTCCAGCTTGAGATGAAATATGGATACCCACAGCTGCTGCTGATAGCATTTAGTGCTTGCACAACAGTGCTTGTTGCAGTCCACCTATTTGCCCTCCTGATCAGCACATGCATCCTGCCCAATGTAGAAGCTGTGAGTAACATTCATAATCTGAACTCTGTCAATGAATCCCCACATGATCGTATGCATCCCTACATTGAGTTGGCCTGGGGATTTTCCACAGCTCTTGGGATCCTTCTTTTTCTTGCAGAAGTTGTTCTTTTGTGCTGGATAAAATTTCTACCCATAGACTCTGCATCAACACGAAATGAAACCACTGCAACTCAAAAGCCGCGTGGAAATGCAGGGTGGAACTCTGCACTGATTTCAACCATTATTATGGTGCCTGTTGGAATCATCTTTGTTATCTTTACTATTCATTTCTATCGTACTCTAGTGAGGCATAAAACAGAGCGTCATCATCAAGAAATAGAGGAACTCCATAAATTGAAAGTACAACTTGATGGACATGATCGGGGCATAAATGTAGTGTAAGTAAGTTAGAGCAGAGATGCACTGCGAGTTCACACCTATCAGAGACATAAAACTGAGGTGTAAGACCTTTGGTCAGAAATGTGCACAGTGCAGCCCGTTTTTACTCGCTGAGAAAGGGCAAGAATCAAAACAAATGACCCTATATTTTACAGTGCCTCTATGACTAGTTTATTTACTTTGGCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)