Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK6588.3                            5 END     2          33       40                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012099665 Xt7.1-XZT19720.3 - 6 ESTs
                                                                       ..-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT19720.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTGTGTTTGCTGGGGGGATTATCACTGGGATTTACACAACCAATTCTCCAGAAGCGTGTCATTATGTTGCAAGTGACTGCAAAATGAACATAATTGTGGTTGAGAATCAGAAACAGCTGGAGAAAATCCTGCAGATTTGGGATGGCCTACCTCATCTTAAAGCTGTTGTTCAGTACAAAGGCAACTTGCAGGAGAAGAGACCAAATTTATATACGTGGGAAGAATTCATGGAATTTGGGAAGGATATTGCAGATGCTCACTTGGATGACATCATAAACTCACAGAAAGCCAACCAATGCTGTGTCCTCATCTACACTTCTGGTACCACTGGAAACCCCAAAGGAGTTATGCTGAGCCATGACAATGTATGGGGAATTAAAATCCATGCAAGCCGTGCAGGTGATATGATACCTGCAGAAATCCAGCAGGAAACCATAGTCAGTTACCTGCCTCTCAGTCACATAGCAGCCCAGATATATGACCTGTGGACTGGAATTAAATGGGGAGAACATGTATTCTTTGCAGATCCAGATGCTCTTAAGGGTTCCTTGGTGGACACACTGAGGGAAGTGCAACCTACATCCCATATGGGTGTCCCACAGATCCAGATGCTCTTAAGGTCAGTATATAAAAAGAAATCGCTGTTGTCAGGAACTGTCAGAAAGATGGTTCTGTCCTGGGCAATGTCCCTCAGCTTAGAGAAGAACCTAAGCCCTGCCAGCAGTGGGCTTAAGACATTTCTTCCATCACTGGTGGATTACTTGGTCCTGGCAAAGATACGTAAACTCCTAGGATTTTCTTGTTTTAGTATAGATCTTCATAATTATTGACCTCAACGACCATATTTCCTTTTCAGTTGCAAGCTAGAAATAGGCAATATGCAAAATAAAAAATAAAGGTCTACTTCTCTAATATACTAAAAGTTAATTTAAAAGTGAAAATCTTTAACAGTGGAGATTAAAGCCTCTGGGAATGGTGACTGTAACAGTGAAAATGCTATGCACTTGCTTGGTACTGTGGAACAGCAGATATAGTGAGATGGCGCCTCTAACAGCAGGCATATTATCTTCTGATGAGATAGATCTTGTAACAGTGGGACTAATATGCTCTTGGAAAAGACTATGGAATAACGGTACAGTAGGGTAATATGGTGCCTGTAACAGTGGGTATAATATGCATTGGTAGGAACTGTATGGTATTATGTACAATTGGTTGAGATAGTGCCTGTAACAGTGGGAATCATATACTGTTTGTAAGAACTGTGCCATAACAAGTATAGTAGAGCGAGATGGTGCCTTTAACAGAGGGCTATGGAATCTATGGTGGCAGATACCATTGCACTCATACTGGGGTAAGGCGGGGTCTGCATTGCTAGTGCACTAAAGCTACCA
                                                  Xt7.1-CHK-1008240769                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGCTGGGGGGATTATCACTGGGATTTACACAACCAATTCTCCAGAAGCGTGTCATTATGTTGCAAGTGACTGCAAAATGAACATAATTGTGGTTGAGAATCAGAAACAGCTGGAGAAAATCCTGCAGATTTGGGATGGCCTACCTCATCTTAAAGCTGTTGTTCAGTACAAAGGCAACTTGCAGGAGAAGAGACCAAATTTATATACGTGGGAAGAATTCATGGAATTTGGGAAGGATATTGCAGATGCTCACTTGGATGACATCATAAACTCACAGAAAGCCAACCAATGCTGTGTCCTCATCTACACTTCTGGTACCACTGGAAACCCCAAAGGAGTTATGCTGAGCCATGACAATGTATGGGGAATTAAAATCxxxxCxAGCCGTGCAGGTGATATGATACCTGCAGAAATCCAGCAGGAAACCATAGTCAGTTACCTGCCTCTCAGTCACATAGCAGCCCAGATATATGACCTGTGGACTGGAATTAAATGGGGAGAACATGTATTCTTTGCAGATCCAGATGCTCTTAAGGGTTCCTTGGTGGACACACTGAGGGAAGTGCAACCTACATCCCATATGGGTGTCCCAxxGxTxCAGATGCTCTTAAGGTCAGTATATAAAAAGAAATCGxxxxxxTCAGGAACTGTCAGAAAGATGGTTCTGTCCTGGGCAATGTCCCTCAGCTTAGAGAAGAACCTAAGCCCTGCCAGCAGTGGGCTTAAGACATTTCTTCCATCACTGGTGGATTACTTGGTCCTGGCAAAGATACGTAAACTCCTAGGATTTTCTTGTTxTxxxATAGATCTTCATAATTATTGACCTCAACGACCATATTTCCTTTTCAGTTGCAAGCTAGAAATAGGCAATATGCAAAATAAAAAATAAAGGTCTACTTCTCTAATATACTAAAAGTTAATTTAAAAGTGAAAATCTTTAACAGTGGAGATTAAAGCCTCTGGGAATGGTGACTGTAACAGTGAAAATGCTATGCACTTGCTTGGTACTGTGGAACAGCAGATATAGTGAGATGGCGCCTCTAACAGCAGGCATATTATCTTCTGATGAGATAGATCTTGTAACAGTGGGACTAATATGCTCTTGGAAAAGACTATGGAATAACGGTACAGTAGGGTAATATGGTGCCTGTAACAGTGGGTATAATATGCATTGGTAGGAACTGTATGGTATTATGTACAATTGGTTGAGATAGTGCCTGTAACAGTGGGAATCATATACTGTTTGTAAGAACTGTGCCATAACAAGTATAGTAGAGCGAGATGGTGCCTTTAACAGAGGGCTATGGAATCTATGGTGGCAGATACCATTGCACTCATACTGGGGTAAGGCGGGGTCTGCATTGCTAGTGCACTAAAGCTACCAAAAGTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     3     5     3     5     3     5     3     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2
                                                                                                                                                                                            PROTEIN --- Sc ---- 2e-010     NP_013974.1 Faa4p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PREDICTED - Xt ---- 1e-011     AAH84450.1 Hypothetical LOC496479 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 1e-015     NP_499799.1 fatty acid Coenzyme A ligase (75.8 kD) (3O630) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 2e-016     XP_787252.2 PREDICTED: similar to MGC138948 protein, partial [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 1e-044     NP_524698.1 bubblegum CG4501-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Xl ---- 4e-081     AAI10944.1 MGC53673 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PREDICTED - ?? ---- 4e-081     NP_001079494.1 hypothetical protein LOC379181 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PREDICTED - Dr ---- 2e-081     XP_708433.1 PREDICTED: similar to MGC53673 protein isoform 2 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PROTEIN --- Mm ---- 7e-094     NP_444408.1 lipidosin; lipidosis-related protein lipidosin; bubblegum [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Hs ---- 1e-094     NP_055977.3 lipidosin; bubblegum; very long-chain acyl-CoA synthetase [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 2e-107     XP_413747.2 PREDICTED: similar to Acyl-CoA synthetase bubblegum family member 1 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT19720.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG------------TAA---------------------TAA---------TAA---TGA------------------------------------------------------------ATG------------------------------TAGTGA---------------------------------TGATGA---------------------------ATG---------------ATG---TAA---------------------------TAA---------TAA---------------------------------------------------------------------------------TAA------------------------------------------TAA---------ATG------ATG------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                   ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                          ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                  ...
  5   1   2      skin Tad5 PIPE in                         XZT19720.5p                                                                                                  CGGACGCGTGGGGAAGAGTGAAGTTTTTAGTTTTCTTCACTGAATGAAACATGCAAGAACCACTTTCTCATTGCAACTTTGGGAAGAATATCTAGGAATATTTACAACTACTGATCTAAGAAAGAAGAAAACTACTTAACAGATCAATTTTGTATATATAGTCCATGGAGTCCTCAGAGGTGGCTGATCAATTCGTTGATGGACCAATCAAGACAACTGAAGAGAAATTATGGACCACAGAGGCAAATGGCTCAGTTCAGCTTCGGATAGATGCTTTATGCCCTCAGAGTCCTATTACTGTGCACCAGATGTTTCTTGAGTCTGTGGATAAATATGGCCCTTTGGATGCATTGTCTACCAAGAGGAATGGAATATGGGAACATGTTACTTTTATGGACTACTACAAGCTCTGTCGTCAAGCTGCCAAAAGTTTCTTAAAGCTTGGTCTAGAACGTTTCCACAGTGTCGGAATTTTGGGGTTTAACTCAGAGGAATGGTTTATTTCAGCAATTGGAACTGTGTTTGCTGGGGGGATTATCACTGGGATTTACACAACCAATTCTCCAGAAGCGTGTCATTATGTTGCAAGTGACTGCAAAATGAACATAATTGTGGTTGAGAATCAGAAACAGCTGGAGAAAATCCTGCAGATTTGGGATGGCCTACCTCATCTTAAAGCTGTTGTTCAGTACAAAGGCAACTTGCAGGAGAAGAGACCAAATTTATATACGTGGGAAGAATTCATGGAATTTGGGAAGGATATTGCAGATGCTCACTTGGATGACATCATAAACTCACAGAAAGCCAACCAATGCTGTGTCCTCATCTACACTTCTGGTACCACT
  3   1   2       bld HeRe                              EC2CAA3DC05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTGTGTTTGCTGGGGGGATTATCACTGGGATTTACACAACCAATTCTCCAGAAGCGTGTCATTATGTTGCAAGTGACTGCAAAATGAACATAATTGTGGTTGAGAATCAGAAACAGCTGGAGAAAATCCTGCAGATTTGGGATGGCCTACCTCATCTTAAAGCTGTTGTTCAGTACAAAGGCAACTTGCAGGAGAAGAGACCAAATTTATATACGTGGGAAGAATTCATGGAATTTGGGAAGGATATTGCAGATGCTCACTTGGATGACATCATAAACTCACAGAAAGCCAACCAATGCTGTGTCCTCATCTACACTTCTGGTACCACTGGAAACCCCAAAGGAGTTATGCTGAGCCATGACAATGTATGGGGAATTAAAATCTTACCTGAATGGCCAAGGATTACATCATAGTTACTGTATTTGTTTCCTCTCCAACACAGATAACCTGGACCGCTGCCCATGCAAGCCGTGCAGGTGATATGATACCTGCAGAAATCCAGCAGGAAACCATAGTCAGTTACCTGCCTCTCAGTCACATAGCAGCCCAGATATATGACCTGTGGACTGGAATTAAATGGGGAGAACATGTATTCTTTGCAGATCCAGATGCTCTTAAGGTCAGTATATAAAAAGAAATCGCTGTTGTA
  5   1   2      seed Brn3      out                        CAAK6588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAACAGCTGGAGAAAATCCTGCAGATTTGGGATGGCCTACCTCATCTTAAAGCTGTTGTTCAGTACAAAGGCAACTTGCAGGAGAAGAGACCAAATTTATATACGTGGGAAGAATTCATGGAATTTGGGAAGGATATTGCAGATGCTCACTTGGATGACATCATAAACTCACAGAAAGCCAACCAATGCTGTGTCCTCATCTACACTTCTGGTACCACTGGAAACCCCAAAGGAGTTATGCTGAGCCATGACAATATAACCTGGACTGCTGCCCATGCAAGCCGTGCAGGTGATATGATACCTGCAGAAATCCAGCAGGAAACCATAGTCAGTTACCTGCCTCTCAGTCACATAGCAGCCCAGATATATGACCTGTGGACTGGAATTAAATGGGGAGAACATGTATTCTTTGCAGATCCAGATGCTCTTAAGGGTTCCTTGGTGGACACACTGAGGGAAGTGCAACCTACATCCCATATGGGTGTCCCAAGGGTGTGGGAAAAAATCATGGAGCATATCAAAGATGTGTCAGCACAATCAGGAACTGTCAGAAAGATGGTTCTGTCCTGGGCAATGTCCCTCAGCTTAGAGAAGAACCTAAGCCCTGCCAGCAGTGGGCTTAAGACATTTCTTCCATCACTGGTGGATTACTTGGTCCTGGCAAAGATACGTAAACTCCTAGGATTTTCTTGTTGTCAAAAACATTTCTCAGGAGCTGCACCAATTTCCCTGGAAACCCTAGAATTTTTCCTTGGCCCTCATATCACATTGTATGAAGCATATGGCATGAGTGAGACAACAGGACCCCACTGTATGTCTGGTCCACAAACACAT
  5   1   2       bld Brn3      out                        CAAK2766.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCTTAAGGGTTCCTTGGTGGACACACTGAGGGAAGTGCAACCTACATCCCATATGGGTGTCCCAAGGGTGTGGGAAAAAATCATGGAGCATATCAAAGATGTGTCAGCACAATCAGGAACTGTCAGAAAGATGGTTCTGTCCTGGGCAATGTCCCTCAGCTTAGAGAAGAACCTAAGCCCTGCCAGCAGTGGGCTTAAGACATTTCTTCCATCACTGGTGGATTACTTGGTCCTGGCAAAGATACGTAAACTCCTAGGATTTTCTTGTTGTCAAAAACATTTCTCAGGAGCTGCACCAATTTCCCTGGAAACCCTAGAATTTTTCCTTGGCCTCAATATCACATTGTATGAAGCATATGGCATGAGTGAGACAACAGGACCCCACTGTATGTCTGGTCCACAAACACATCAATTGCAATGCTGCGGTAAAGTCGTCCCTGGATGTCAAGTGAAACTGGTAAACAAAGATGCAGAGGGAAATGGAGAGATCTGTTTTTGGGGCAGGACTGTATTCATGGGCTATCTGAACATGGACAGCAAAACAAAGGAAGCATTCGATGAAGAGGGATGGCTGCACTCAGGAGATATTGGGAAGATGGATGCTGAAGGCTTCCTGCAAGTAACTGGGAGGATCAAAGGTACAGTACAATTCTGTAAAGACACTATGGAACTAAACAGCAAGTAATTACAGATAGTACGGTTTTATCTCCCAGAGCACTGTGAATTCAGATTCCTTAGAGGCAACGGACAATCTAACCCAGGAAGCAATACGGTTTTGCCAGGATGTTGGAAGTAAAGCTACAAAAGTGTCAGAAATTGTTGGAGGAAAGACCAGCTGTGTACAAAGCTATTGA
  3   1   2      skin Tad5 PIPE in                         XZT19720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGCAGATCCAGATGCTCTTAAGGTCAGTATATAAAAAGAAATCGCTGTTGTATCTAAAATATCCTTTTTCCTCCTGTGAGTTGCCAGGTTTTGTATATTACTTTAAAATGATGATTATCAAGTGCTTTGGGAAAAAAGAAATAAATAAAATAATAGGGATCATTGGATACTGATCTTTTAACCCAGGGATTTTAGTCTCCATGATGTTTAGTATAGATCTTCATAATTATTGACCTCAACGACCATATTTCCTTTTCAGTTGCAAGCTAGAAATAGGCAATATGCAAAATAAAAAATAAAGGTCTACTTCTCTAATATACTAAAAGTTAATTTAAAAGTGAAAATCTTTAACAGTGGAGATTAAAGCCTCTGGGAATGGTGACTGTAACAGTGAAAATGCTATGCACTTGCTTGGTACTGTGGAACAGCAGATATAGTGAGATGGCGCCTCTAACAGCAGGCATATTATCTTCTGATGAGATAGATCTTGTAACAGTGGGACTAATATGCTCTTGGAAAAGACTATGGAATAACGGTACAGTAGGGTAATATGGTGCCCGTAACAGTGGGTATAATATGCATTGGTAGGAACTGTATGGTATTATGTACAATTGGTTGAGATAGTGCCTGTAACAGTGGGAATCATATACTGTTTGTAAGAACTGTGCCATAACAAGTATAGTAGAGCGAGATGGTGCCTTTAACAGAGGGCTATGGAATCTATGGTGGCAGATACCATTGCACTCATACTGGGGTAAGGCGGGGTCTGCATTGCTAGTGCACTAAAGCTACCAAAAGTCCTGTC
  3   1   2       bld Brn2      out                       CAAJ20407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGATCCAGATGCTCTTAAGGTCAGTATATAAAAAGAAATCGCTGTTGTACCTAAAATATCTTTTTTCCTCCTGTGAGTTGCCAGGTTTTGTATATTACTTTAAAATGATGATTATCAAGTGCTTTGGGAAAAAAGAAATAAATAAAATAATAGGGATCATTGGATACTGATCTTTTAACCCAGGGATTTTAGTCTCCATGATGTTTAGTATAGATCTTCATAATTATTGACCTCAACGACCATATTTCCTTTTCAGTTGCAAGCTAGAAATAGGCAATATGCAAAATAAAAAATAAAGGTCTACTTCTCTAATATACTAAAAGTTAATTTAAAAGTGAAAATCTTTAACAGTGGAGATTAAAGCCTTTGGGAATGGTGACTGTTACAGTGAAAATGCTATGCACTTGCTTGGTACTGTGGAACAGCAGATATAGTGAGATGGCGCCTCTAACAGCAGGCATATTATCTTCTGATGAGATAGATCTTGTAACAGTGGGACTAATATGCTCTTGGAAAAGACTATGGAATAACGGTACAGTAGGGTAATATGGTGCCTGTAACAGTGGGTATAATATGCATTGGTAGGAACTGTATGGTATTATGTACAATTGGTTGAGATAGTGCCTGTAACAGTGGGAATCATATACTGTTTGTAAGAACTGTGCCATAACAAGTATAGTAGAGCGAGATGGTGCCTTTAACAGAGGGCTATGGAATCTATGGTGGCAGATACCATTGCACTCATACTGGGGTAAGGCGGGGTCTGCATTGCTAGTGCACTAAAGCTACCAAAAGTCCTGTCAAAAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)