Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 09 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM7345.3                            8 END     2         100       25                (no blast hit)

 This cluster: approximate FL confidence score = 85%

 1012100269 Xt7.1-CAAM8000.3 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAM8000.3 CCCAGGCAGTTGCAACACCGAACGCAAATAAGAAGCTGACAGACAGCAGAGGAGCAATGCAGCCCGGATCAATGGTTTCCAAGCACACAGTCACTCATTCGCTGGGATTTGCGGATTACTAGGAAATGTGCCTGGCTGCATCCTTCCAAGAGTTTTAAGAAGCATTTCCAGAACTGGTGGGGATTAGGTCAATGGATTCCAGGATTCCTCACAGTATCACAGTCGTGCCCAACGCTGCCATGGTACAGCCATTGCTGGATGGCCGGGTGCCTTATGGAAGGTTACAGCATCCACTCACCATCCTGCCAATTGACCAGATGAAAACCAGCCATTTGGAAAATGATTACATTGACAATCCTTCTTTGAGTCAGCTGGCTAATCAGAAGCTTGTCAGGGGTCCTCATGAACCCACGCTCATCAATCAGCATTTGCAGAGGTGTGAAGCAGACATCACACACCCCTGGATATCTTTTAGTGGGCGCCCAAGCTCAATTAGCAGCAGCAGTAGCACCTCCTCAGATCAGAGACTTTTGGACCACATGGCTCCACCTCCAGTGGTGGATCAGTCACCACCCAGGGCAGTGAGGATACAGCCTAAAGTTATAAATTGCAAGCCTCAGGATGTAAAGGGACCCATGGCCCAGGAGCTAGACAAGCACTTCTTACTGTGTGAGGCTTGTGGAAAGTGCAAATGCAAAGACTGTACCACTCCTCGGACATTGCCTTCTTGTTGGGTGTGCCACCAGGAATGTCTGT
                                                  Xt7.1-CHK-1008260154       CAGTTGCAACACCGAACGCAAATAAGAAGCTGACAGACAGCAGAGGAGCAATGCAGCCCGGATCAATGGTTTCCAAGCACACAGTCACTCATTCGCTGGGATTTGCGGATTACTAGGAAATGTGCCTGGCTGCATCCTTCCAAGAGTTTTAAGAAGCATTTCCAGAACTGGTGGGGATTAGGTCAATGGATTCCAGGATTCCTCACAGTATCACAGTCGTGCCCAACGCTGCCATGGTACAGCCATTGCTGGATGGCCGGGTGCCTTATGGAAGGTTACAGCATCCACTCACCATCCTGCCAATTGACCAGATGAAAACCAGCCATTTGGAAAATGATTACATTGACAATCCTTCTTTGAGTCAGCTGGCTAATCAGAAGCTTGTCAGGGGTCCTCATGAACCCACGCTCATCAATCAGCATTTGCAGAGGTGTGAAGCAGACATCACACACCCCTGGATATCTTTTAGTGGGCGCCCAAGCTCAATTAGCAGCAGCAGTAGCACCTCCTCAGATCAGAGACTTTTGGACCACATGGCTCCACCTCCAGTGGTGGATCAGTCACCACCCAGGGCAGTGAGGATACAGCCTAAAGTTATAAATTGCAAGCCTCAGGATGTAAAGGGACCCATGGCCCAGGAGCTAGACAAGCACTTCTTACTGTGTGAGGCTTGTGGAAAGTGCAAATGCAAAGACTGTACCACTCCTCGGACATTGCCTTCTTGTTGGGTGTGCCACCAGGAATGTCTGTGTTCGG
                                                      consensus depths      1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     191      50 
                                               BLH MIN     191      40 
                                               BLH MPR     122      40 
                                               BLH OVR     191     157 
                                               CDS MIN     191      40 
                                               ORF LNG     191       6 
                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 2e-021     AAK51356.1 sprouty2 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 2e-021     NP_001082238.1 sprouty 2 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                         PROTEIN --- Xt ---- 3e-023     AAU43765.1 Sprouty1 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 5e-060     NP_571901.1 sprouty (Drosophila) homolog 4 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                 PROTEIN --- Hs ---- 9e-075     NP_112226.2 sprouty homolog 4 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 5e-075     NP_036028.2 sprouty homolog 4 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 2e-084     NP_001073203.1 sprouty homolog 4 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAM8000.3                                                         ATG------------ATG---------------------------------------------TAG---ATG---------------------------TAA---------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  3  -1   2       bld Te3       out                        CAAM8000.3p CCCAGGCAGTTGCAACACCGAACGCAAATAAGAAGCTGACAGACAGCAGAGGAGCAATGCAGCCCGGATCAATGGTTTCCAAGCACACAGTCACTCATTCGCTGGGATTTGCGGATTACTAGGAAATGTGCCTGGCTGCATCCTTCCAAGAGTTTTAAGAAGCATTTCCAGAACTGGTGGGGATTAGGTCAATGGATTCCAGGATTCCTCACAGTATCACAGTCGTGCCCAACGCTGCCATGGTACAGCCATTGCTGGATGGCCGGGTGCCTTATGGAAGGTTACAGCATCCACTCACCATCCTGCCAATTGACCAGATGAAAACCAGCCATTTGGAAAATGATTACATTGACAATCCTTCTTTGAGTCAGCTGGCTAATCAGAAGCTTGTCAGGGGTCCTCATGAACCCACGCTCATCAATCAGCATTTGCAGAGGTGTGAAGCAGACATCACACACCCCTGGATATCTTTTAGTGGGCGCCCAAGCTCAATTAGCAGCAGCAGTAGCACCTCCTCAGATCAGAGACTTTTGGACCACATGGCTCCACCTCCAGTGGTGGATCAGTCACCACCCAGGGCAGTGAGGATACAGCCTAAAGTTATAAATTGCAAGCCTCAGGATGTAAAGGGACCCATGGCCCAGGAGCTAGACAAGCACTTCTTACTGTGTGAGGCTTGTGGAAAGTGCAAATGCAAAGACTGTACCACTCCTCGGACATTGCCTTCTTGTTGGGTGTGCAACCAGGAATGTCTGTGTTC
  5   1   2   14 seed Te3  5g3  out                        CAAM7345.5p .CCAGGCAGTTGCAACACCGAACGCAAATAAGAAGCTGACAGACAGCAGAGGAGCAATGCAGCCCGGATCAATGGTTTCCAAGCACACAGTCACTCATTCGCTGGGATTTGCGGATTACTAGGAAATGTGCCTGGCTGCATCCTTCCAAGAGTTTTAAGAAGCATTTCCAGAACTGGTGGGGATTAGGTCAATGGATTCCAGGATTCCTCACAGTATCACAGTCGTGCCCAACGCTGCCATGGTACAGCCATTGCTGGATGGCCGGGTGCCTTATGGAAGGTTACAGCATCCACTCACCATCCTGCCAATTGACCAGATGAAAACCAGCCATTTGGAAAATGATTACATTGACAATCCTTCTTTGAGTCAGCTGGCTAATCAGAAGCTTGTCAGGGGTCCTCATGAACCCACGCTCATCAATCAGCATTTGCAGAGGTGTGAAGCAGACATCACACACCCCTGGATATCTTTTAGTGGGCGCCCAAGCTCAATTAGCAGCAGCAGTAGCACCTCCTCAGATCAGAGACTTTTGGACCACATGGCTCCACCTCCAGTGGTGGATCAGTCACCACCCAGGGCAGTGAGGATACAGCCTAAAGTTATAAATTGCAAGCCTCAGGATGTAAAGGGACCCATGGCCCAGGAGCTAGACAAGCACTTCTTACTGTGTGAGGCTTGTGGAAAGTGCAAATGCAAAGACTGTACCACTCCTCGGACATTGCCTTCTTGTTGGGTGTGCCACCAGGAATGTCTGTGTTCGGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)