Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 87%

 1012100704 Xt7.1-IMAGE:8953859.5 - 2 ESTs
                                                                       .-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-IMAGE:8953859.5                                                                        GGAGGGGAAGATGTGACAGAGTTGGCAGGTTGGTGAGTGAGTGCAATAAGGCAGATAGTGGGGACCCCGGGGCCCAAGGAGGGACTGTGGGCACAGATACAGTCAGAGATCTGGATAAGGAAGGCTGTGTGGCAGCTCCCGCAGGAGGATTCGCTGGAAGTGCATCTCCCACCCCATAGGAGCCATGGATTATACCACTCTGACCACACAGGAGCCCCTCCCTAATTATACAGAGTCAGCTCTTGCAAGCACTTCTGAGGACTCAGAGTTCCTGTATGGTCTGGGGGGTGAAAGCAGCCCTGGTCATTATGGGGGGACAGTGAGCTCCCGAGCAGTGGGGGGATTCCGACATTCTCCAGTGCTTCAGACATTCCCTTTACATTGGCCAGAAACCAGTGTTGGGATCCCCCACAGCCTGACAGCATATGGGAGAAGCCCAGGAACAGTGCCTTTATACCCCTCAGCTGCTTCGTCCTTTGGCCCTATTACGTCTCCTCCTTTGTACAATGCTGCTCCTTTCTTGTTGGGCTCAGCTCCTCCAGCAGAGCATGAAGGTAGTCCAAAGTTCCTGGAGACCTTAAAGACGGAGAGGACAAGCCCACTGACCACTGATCTTTTGCCCTTGGAATCAAGAAGCCCCAGTTTGCCCCAGGTGGGGTATCTAGGAGTAGGAGGACAGGAGTTCAGCCCCAGTCTGTTTCAGTCAACAGAAGATCGCGAGTGTGTGAACTGTGGAGCCACAGTGACTCCATTGTGGAGGCGAGATCTGAGTGGGCACTACCTGTGCACGCCTGTGCCTGTACCACAAATGAACGGACAGATCGTCACTATTACGACCAAGAACGCCTGATCGTCAGTAGAGAGCTGGACTCAGTGCAGTATTGCCACACAGCACCACCACCTGTGAGACCGATGCAGCGGAGACCTTGTCTGTACGCCTTGGTGCCT
                                                  Xt7.1-CHK-1008261081                                                                              GAAGATGTGACAGAGTTGGCAGGTTGGTGAGTGAGTGCAATAAGGCAGATAGTGGGGACCCCGGGGCCCAAGGAGGGACTGTGGGCACAGATACAGTCAGAGATCTGGATAAGGAAGGCTGTGTGGCAGCTCCCGCAGGAGGATTCGCTGGAAGTGCATCTCCCACCCCATAGGAGCCATGGATTATACCACTCTGACCACACAGGAGCCCCTCCCTAATTATACAGAGTCAGCTCTTGCAAGCACTTCTGAGGACTCAGAGTTCCTGTATGGTCTGGGGGGTGAAAGCAGCCCTGGTCATTATGGGGGGACAGTGAGCTCCCGAGCAGTGGGGGGATTCCGACATTCTCCAGTGCTTCAGACATTCCCTTTACATTGGCCAGAAACCAGTGTTGGGATCCCCCACAGCCTGACAGCATATGGGAGAAGCCCAGGAACAGTGCCTTTATACCCCTCAGCTGCTTCGTCCTTTGGCCCTATTACGTCTCCTCCTTTGTACAATGCTGCTCCTTTCTTGTTGGGCTCAGCTCCTCCAGCAGAGCATGAAGGTAGTCCAAAGTTCCTGGAGACCTTAAAGACGGAGAGGACAAGCCCACTGACCACTGATCTTTTGCCCTTGGAATCAAGAAGCCCCAGTTTGCCCCAGGTGGGGTATCTAGGAGTAGGAGGACAGGAGTTCAGCCCCAGTCTGTTTCAGTCAACAGAAGATCGCGAGTGTGTGAACTGTGGAGCCACAGTGACTCCATTGTGGAGGCGAGATCTGAGTGGGCACTACCTGTGCACGCCTGTGCCTGTACCACAAATGAACGGACAGATCGTCACTATTACGACCAAGAACGCCTGATCGTCAGTAGAGAGCTGGACTCAGTGCAGTATTGCCACACAGCACCACCACCTGTGAGACCGATGCAGCGGAGACCTTGTCTGTACGCCTTGGTGCCTTCTATT
                                                      consensus depths                                                                             1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     184      28                                                                        
                                               BLH MIN     136      38                                                                        
                                               BLH OVR     184     219                                                                        
                                               ORF LNG     184       8                                                                        
                                                                                                                                                                                                           PROTEIN --- Sp ---- 5e-009     NP_999704.1 GATA transcription factor [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 3e-009     NP_731211.1 grain CG9656-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PROTEIN --- Ci ---- 7e-011     BAE06473.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                                                                                                                    PROTEIN --- Gg ---- 3e-011     NP_001003797.1 GATA binding factor-2 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN -== Xt ==== 4e-014     NP_001004967.1 MGC89310 protein [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 1e-019     NP_571309.1 GATA-binding protein 1 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 1e-023     NP_032115.1 GATA binding protein 1 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 3e-025     NP_002040.1 GATA binding protein 1 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 6e-103     AAA49722.1 GATA binding factor-1 [Xenopus laevis]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 6e-103     NP_001079244.1 GATA binding factor-1b [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-IMAGE:8953859.5                                                                                  ATGTGA---------------------TGA------TAA------TAG---------------------------------------------------------TAA------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------TGA------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2   30  bld Eye  5x3  out                        CCAX5866.b1 .......................................................................GGAGGGGAAGATGTGACAGAGTTGGCAGGTTGGTGAGTGAGTGCAATAAGGCAGATAGTGGGGACCCCGGGGCCCAAGGAGGGACTGTGGGCACAGATACAGTCAGAGATCTGGATAAGGAAGGCTGTGTGGCAGCTCCCGCAGGAGGATTCGCTGGAAGTGCATCTCCCACCCCATAGGAGCCATGGATTATACCACTCTGACCACACAGGAGCCCCTCCCTAATTATACAGAGTCAGCTCTTGCAAGCACTTCTGAGGACTCAGAGTTCCTGTATGGTCTGGGGGGTGAAAGCAGCCCTGGTCATTATGGGGGGACAGTGAGCTCCCGAGCAGTGGGGGGATTCCGACATTCTCCAGTGCTTCAGACATTCCCTTTACATTGGCCAGAAACCAGTGTTGGGATCCCCCACAGCCTGACAGCATATGGGAGAAGCCCAGGAACAGTGCCTTTATACCCCTCAGCTGCTTCGTCCTTTGGCCCTATTACGTCTCCTCCTTTGTACAATGCTGCTCCTTTCTTGTTGGGCTCAGCTCCTCCAGCAGAGCATGAAGGTAGTCCAAAGTTCCTGGAGACCTTAAAGACGGAGAGGACAAGCCCACTGACCACTGATCTTTTGCCCTTGGAATCAAGAAGCCCCAGTTTGCCCCAGGTGGGGTATCTAGGAGTAGGAGGACAGGAGTTCAGCCCCAGTCTGTTTCAGTCAACAGAAGATCGCGAGTGTGTGAACTGTGGAGCCACAGTGACTCCATTGTGGAGGCGAGATC
  5   1   2      seed In62 5g                         IMAGE:8953859.5p                                                                                             GCCCCGGTTCGGTGAGTGAGTGCAATAAGGCAGATAGTGGGGACCCCGGGGCCCAAGGAGGGACTGTGGGCACAGATACAGTCAGAGATCTGGATAAGGAAGGCTGTGTGGCAGCTCCCGCAGGAGGATTCGCTGGAAGTGCATCTCCCACCCCATAGGAGCCATGGATTATACCACTCTGACCACACAGGAGCCCCTCCCTAATTATACAGAGTCAGCTCTTGCAAGCACTTCTGAGGACTCAGAGTTCCTGTATGGTCTGGGGGGTGAAAGCAGCCCTGGTCATTATGGGGGGACAGTGAGCTCCCGAGCAGTGGGGGGATTCCGACATTCTCCAGTGCTTCAGACATTCCCTTTACATTGGCCAGAAACCAGTGTTGGGATCCCCCACAGCCTGACAGCATATGGGAGAAGCCCAGGAACAGTGCCTTTATACCCCTCAGCTGCTTCGTCCTTTGGCCCTATTACGTCTCCTCCTTTGTACAATGCTGCTCCTTTCTTGTTGGGCTCAGCTCCTCCAGCAGAGCATGAAGGTAGTCCAAAGTTCCTGGAGACCTTAAAGACGGAGAGGACAAGCCCACTGACCACTGATCTTTTGCCCTTGGAATCAAGAAGCCCCAGTTTGCCCCAGGTGGGGTATCTAGGAGTAGGAGGACAGGAGTTCAGCCCCAGTCTGTTTCAGTCAACAGAAGATCGCGAGTGTGTGAACTGTGGAGCCACAGTGACTCCATTGTGGAGGCGAGATCTGAGTGGGCACTACCTGTGCACGCCTGTGCCTGTACCACAAATGAACGGACAGATCGTCACTATTACGACCAAGAACGCCTGATCGTCAGTAGAGAGCTGGACTCAGTGCAGTATTGCCACACAGCACCACCACCTGTGAGACCGATGCAGCGGAGACCTTGTCTGTACGCCTTGGTGCCTTCTATTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)