Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 71%

 1012100798 Xt7.1-XZG11565.5 - 5 ESTs
                                                                       ......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG11565.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGTCACCAAGAATCTACCCAGAGATGGCCTTCCTCAGCCTCTTCTTGTGCCTTGTGTTTAGCTCCCCACTGATGGCGATGCCTCCAGCCCTACAGGGGAGAAAGGCCATCAGTCCAGCTTCTATCCTAAAGGGCCCATCCACAGATAATGGAGCCAGAGACTTTCATGGAAGGAAGTTCCCCCATTTCATGATGCAGCTGTACCAGAATATCATCAGCAGAAGAGATAAAGATCTCTCCAACCTGGAACATCCAACTCTTCAGGAATCTGATACCGTCCAAAGCTTCATTGCTAAAAGTTACACTACAGTGGGAAATCGCTGGACCTTGTTCTTTGACATGTCCTCCATCTCCACAAGCAATGAGCTGAAGTTGGCTGAGCTACGTATTTGCCTCCCTTCCTTTGGGAAGTCCCACAGTGTGACAGTAGAGATCTACCATACCAAGGACGACAAGGAGAAATTATTCATGGGATCATTCAAGACCAAGATTTCTTCTGCACTAGATGCTGACTGCAAGGTCTTCAACCTCACCATGGTGCTGCACAACTATCTGATCAGGGGAAAGAGATTAATTAAGGATGAATCATACAGGCAAAGGGTCTCCTTCTGAGAGATCTAGAGAAGAGTGCTGCAGAGAAAGGAGCAGAAAATGTAGATACATTGAAACAAGATAAACATCATGTATCCGACTTTGCTGCAGAAAGAATCATACTGGGTGTGTTTGCTAAAGAAAGTTCTCAAGCTAAACCTGATCCCCCCAGCCTTGGCAAGCAGCTGTTCCCTTTAAAGTATGGTATGGCTGATAATGCCAACAAGGTCAATGGATTTCGGAGACTTAGGAGGAACAAGAAAGAGAAAACAAGAATCGATGTGGGTACCACTCCCCCCNAAACCTGTTGAAGAAATCAAACCCAAGTGCAGGAAGGTGGACATGTTTGTGGACATTCAGAAGATCGGATGGGGCAGCTGGATTGTGTATCCCAAGGCATATAATGCATACAGATGTGAATCAGCCTGTGCAGTTCCACTGAATGAGACGGACAATGCAACAAACTATTCCTACATTAAGGTACGGTGTAGATTTCTACTTTCTTAATGTATTTTAGCATCTAAAATAATGGTGGTGTAATGTATTTTTCCACCTTAAAAATACATAAATTATATGTTGAAGGTGGTTTTATTTTGATATACTCTATACTTGCTCGTGTACAGTCCCTCTGATCATGCAATGCATTAATATGGATTCTTTGTGTTTAATTGCAGAGTTTGCTCCCTCTGAGCGACACGGAGAGAAGAGAATGCCCTTCCTGTGTCCCCGTGAAGATGAGGTCCATGTCAATGTTGTACTATGAGAATGAAGATTTTGTTCTGCGGCACCATGAAGAGATGATTGTAGAAGAATGTGGATTCAA
                                                  Xt7.1-CHK-1008242047                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACCAAGAATCTACCCAGAGATGGCCTTCCTCAGCCTCTTCTTGTGCCTTGTGTTTAGCTCCCCACTGATGGCGATGCCTCCAGCCCTACAGGGGAGAAAGGCCATCAGTCCAGCTTCTATCCTAAAGGGCCCATCCACAGATAATGGAGCCAGAGACTTTCATGGAAGGAAGTTCCCCCATTTCATGATGCAGCTGTACCAGAATATCATCAGCAGAAGAGATAAAGATCTCTCCAACCTGGAACATCCAACTCTTCAGGAATCTGATACCGTCCAAAGCTTCATTGCTAAAAGTTACACTACAGTGGGAAATCGCTGGACCTTGTTCTTTGACATGTCCTCCATCTCCACAAGCAATGAGCTGAAGTTGGCTGAGCTACGTATTTGCCTCCCTTCCTTTGGGAAGTCCCACAGTGTGACAGTAGAGATCTACCATACCAAGGACGACAAGGAGAAATTATTCATGGGATCATTCAAGACCAAGATTTCTTCTGCACTAGATGCTGACTGCAAGGTCTTCAACCTCACCATGGTGCTGCACAACTATCTGATCAGGGGAAAGAGATTAATTAAGGATGAATCATACAGGCAAAGGGTCTCCTTCTGAGAGATCTAGAGAAGAGTGCTGCAGAGAAAGGAGCAGAAAATGTAGATACATTGAAACAAGATAAACATCATGTATCCGACTTTGCTGCAGAAAGAATCATACTGGGTGTGTTTGCTAAAGAAAGTTCTCAAGCTAAACCTGATCCCCCCAGCCTTGGCAAGCAGCTGTTCCCTTTAAAGTATGGTATGGCTGATAATGCCAACAAGGTCAATGGATTTCGGAGACTTAGGAGGAACAAGAAAGAGAAAACAAGAATCGATGTGGGTACCACTCCCCCCNAAACCTGTTGAAGAAATCAAACCCAAGTGCAGGAAGGTGGACATGTTTGTGGACATTCAGAAGATCGGATGGGGCAGCTGGATTGTGTATCCCAAGGCATATAATGCATACAGATGTGAATCAGCCTGTGCAGTTCCACTGAATGAGACGGACAATGCAACAAACTATTCCTACATTAAGGTACGGTGTAGATTTCTACTTTCTTAATGTATTTTAGCATCTAAAATAATGGTGGTGTAATGTATTTTTCCACCTTAAAAATACATAAATTATATGTTGAAGGTGGTTTTATTTTGATATACTCTATACTTGCTCGTGTACAGTCCCTCTGATCATGCAATGCATTAATATGGATTCTTTGTGTTTAATTGCAGAGTTTGCTCCCTCTGAGCGACACGGAGAGAAGAGAATGCCCTTCCTGTGTCCCCGTGAAGATGAGGTCCATGTCAATGTTGTACTATGAGAATGAAGATTTTGTTCTGCGGCACCATGAAGAGATGATTGTAGAAGAATGTGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     2     1     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      26      94                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN      26      56                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                               BLH OVR     794     118                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-008     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-008     NP_477311.1 decapentaplegic CG9885-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bf ---- 4e-012     AAL99367.1 nodal-related protein amphinodal [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 3e-011     XP_779934.1 PREDICTED: similar to southpaw isoform 1 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bb ---- 4e-013     BAC82629.1 nodal protein [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 2e-012     NP_038639.1 nodal; early embryo mesoderm formation; transgenic lethal 413.d [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 8e-013     NP_060525.2 mouse nodal homolog precursor [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 7e-015     BAE06590.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ---- 4e-017     XP_424385.1 PREDICTED: similar to nodal-related protein 1 precursor [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 2e-019     NP_851298.1 southpaw [Danio rerio] ---------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 5e-118     AAA82755.1 TGF-beta related growth factor [Xenopus laevis]  ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === ?? ==== 5e-118     NP_001079259.1 nodal related 3, TGF-beta related growth factor [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 5e-136     BAC75530.1 nodal-related protein 3-A [Silurana tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG11565.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------TGA------TAG------------------------------ATGTAG------TGA---------------ATG------------------------------------------------------------------------------------------------------TAA---ATG------------ATG------------ATG---------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------ATG------TAA---------------TAA---------------ATG------------------TGA------------------------------------------ATG---TAA---------------------------------------TGA---------------------------------------TGA---TGA---------------------ATG---ATG---------------------ATG------TGA---TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Gas       in                   TGas097d22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAACATCTCCTCAGCTGGAAGATTCAGGAGTCACCAAGAATCTACCCAGAGATGGCCTTCCTCAGCCTCTTCTTGTGCCTTGTGTTTAGCTCCCCACTGATGGCGATGCCTCCAGCCCTACAGGGGAGAAAGGCCATCAGTCCAGCTTCTATCCTAAAGGGCCCATCCACAGATAATGGAGCCAGAGACTTTCATGGAAGGAAGTTCCCCCATTTCATGATGCAGCTGTACCAGAATATCATCAGCAGAAGAGATAAAGATCTCTCCAACCTGGAACATCCAACTCTTCAGGAATCTGATACCGTCCAAAGCTTCATTGCTAAAAGTTACACTACAGTGGGAAATCACTGGACCTTGTTCTTTGACATGTCCTCCATCTCCACAAGCAATGAGCTGAAGTTGGCTGAGCTACGTATTTGCCTCCCTTCCTTTGGGAAGTCCCACAGTGTGACAGTAGAGATCTACCATACCAAGGACACAAAGGAGAAATTATTCATGGGATCATTCAAGACCAAGATTTCTTCTGCACTAGATGCTGACTGCAAGGTCTTCAACCTCACCATGGTGCTGCACAACTATCTGATCAGGGGAAAGAGATTATTAAAGGATGAATACATACAGGCAAAGGGTCTCCTTCTG
  5   1   2   22 seed Gas7 PIPE                            XZG11565.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCATCTCCTCAGCTGGAAGATATCAGGAGTCACCAAGAATCTACCCAGAGATGGCCTTCCTCAGCCTCTTCTTGTGCCTTGTGTTTAGCTCCCCACTGATGGCGATGCCTCCAGCCCTACAGGGGAGAAAGGCCATCAGTCCAGCTTCTATCCTAAAGGGCCCATCCACAGATAATGGAGCCAGAGACTTTCATGGAAGGAAGTTCCCCCATTTCATGATGCAGCTGTACCAGAATATCATCAGCAGAAGAGATAAAGATCTCTCCAACCTGGAACATCCAACTCTTCAGGAATCTGATACCGTCCAAAGCTTCATTGCTAAAAGTTACACTACAGTGGGAAATCGCTGGACCTTGTTCTTTGACATGTCCTCCATCTCCACAAGCAATGAGCTGAAGTTGGCTGAGCTACGTATTTGCCTCCCTTCCTTTGGGAAGTCCCACAGTGTGACAGTAGAGATCTACCATACCAAGGACGACAAGGAGAAATTATTCATGGGATCATTCAAGACCAAGATTTCTTCTGCACTAGATGCTGACTGCAAGGTCTTCAACCTCACCATGGTGCTGCACAACTATCTGATCAGGGGAAAGAGATTAATTAAGGATGAATCATACAGGCAAAGGGTCTCCTTCTGAGAGATCTAGAGAAGAGTGCTGCAGAGAAAGGAGCAGAAAATGTAGATACATTGAAACAAGATAAACATCATGTATCCGACTTTGCTGCAGAAAGAATCATACTGGGTGTGTTTGCTAAAGAAAGATCTNCAGCTAAACCTGATCCCCCCAGCCTTGGCAAGCAGCTGTTCCCTTTAAAGTATGGTATGGCTG
  5   1   2       bld Gas                            TGas011k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCTTCCTCAGCCTCTTCTTGTGCCTTGTGTTTAGCTCCCCACTGATGGCGATGCCTCCAGCCCTACAGGGGAGAAAGGCCATCAGTCCAGCTTCTATCCTAAAGGGCCCATCCACAGATAATGGAGCCAGAGACTGTCATGGAAGGAAGTTCCCCCATTTCATGATGCAGCTGTACCAGAATATCATCAGCAGAAGAGATAAAGATCTCTCCAACCTGGAACATCCAACTCTTCAGGAATCTGATACCGTCCAAAGCTTCATTGCTAAAAGTTACACTACAGTGGGAAATCGCTGGACCTTGTTCTTTGACATGTCCTCCATCTCCACAAGCAATGAGCTGAAGTTGGCTGAGCTACGTATTTGCCTCCCTTCCTTTGGGAAGTCCCACAGTGTGACAGTAGAGATCTACCATACCAAGGACGACAAGGAGAAATTATTCATGGGATCATTCAAGACCAAGATTTCTTCTGCACTANATGCTGACTGCAAGGTCTTCAACCTCACCATGGTGCTGCACAACTATCTGATCA
  3   1   2      skin Gas       in                    TGas097d22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGAAAAAGGAGCAGAAAATGTAGATACATTAAANCAAGATAAATATCATGTATCTGACTTTGCTGCAGAGAGAATCATACTGGTTGTGTTTGCTAAAGAAAGTTCTCAAGCTAAACCTGATCCCCCCAGCCTTGGCAAGCAGCTGTTCCCTTTAAAGTATGGTATGGCTGATAATGCCAACAAGGTCAATGGATTTCGGAGACTTAGGAGGAACAAGAAAGAGAAAACAAGAATCGATGTGGGTACCACTCCCCCCNAAACCTGTTGAAGAAATCAAACCCAAGTGCAGGAAGGTGGACATGTTTGTGGACATTCAGAAGATCGGATGGGGCAGCTGGATTGTGTATCCCAAGGCATATAATGCATACAGATGTGAATCAGCCTGTGCAGTTCCACTGAATGAGACGGACAATGCAACAAACTATTCCTACATTAAGGTACGGTGTAGATTTCTACTTTCTTAATGTATTTTAGCATCTAAAATAATGGTGGTGTAATGTATTTTTCCACCTTAAAAATACATAAATTATATGTTGAAGGTGGTTTTATTTTGATATACTCTATACTTGCTCGTGTACAGTCCCTCTGATCATGCAATGCATTAATATGGATTCTTTGTGTTTAATTGCAGAGTTTGCTCCCTCTGAGCGACACGGAGAGAAGAGAATGCCCTTCCTGTGTCCCCGTGAAGATGAGGTCCATGTCAATGTTGTACTATGAGAATGAAGATTTTGTTCTGCGGCACCATGAAGAGATGATTGTAGAAGAATGTGGATTCAAGGACATTTAACAGACTTTGCCTCTTAGACTTTTACACCACATCCAACCAACTCCAGCATTTATGCCATTTTAAAAACATTTTTAACTTTTTACACATATTTATCCTTTTTTTAATTATAATCTGTACTAAGAAACTGATTGATGGACTCACTTCCCATAAAAAAAAAAAAAAAAAA
  3   1   1       add Gas0                                 dad51c07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGTTCCCCAAGGCAAATAAGGCAACCAGATGTGAACCAGCCTGTCCAGTTCCCCTGAATGAGACGGACGATGCAACAAACTATTCCTACATTAAGAGTTTGCTCCCTCTGAGCGACACGGAGAGAAGAGAATGCCCTTCCTGTGTCCCCGTGAAGATGAGGTCCATGTCAATGTTGTACTATGAGAATGAAGAGTTTATCCTGCGGCACCATGAAGAGATGATTGTAGAAGAATGTGGATTCAAGGACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)