Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAO466.3                             3 END     3         100      100                gap junction membrane channel protein alpha 3 [Danio rerio]

 This cluster: approximate FL confidence score = 91%

 1012101198 Xt7.1-CAAO5297.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO5297.5 CTCCAACAACTTCTGGTACAATTAATTGAGTTCTGTAAGAGTTAACTGCCCAGGGCCTAATGCAGCAAGGTAGCCCAAAACCATATCACTTTCTACACCATGCTTTATGCATTCTCAGCAGTCTCCGAGGGATGCAGGAAATTGTAACTGGAGGGTTGCTGGCCTGACATCCCTGATAGATCGTAAGCCTTCTTCCTCAGTTAGGAATCCGAAACAATGGGCGACTGGAGTTTTCTGGGGAGACTATTGGAAAATGCTCAAGAACACTCAACAGTCATTGGCAAGGTTTGGTTGACAGTGCTCTTTATCTTCCGGATCCTGGTACTGGGAGCTGCAGCAGAGGAGGTTTGGGGGGATGAACAGTCTGACTTCACTTGCAATACGCAGCAACCAGGTTGTGAGAACGTCTGCTATGACAAAGCATTTCCTATTTCTCACATTAGGTTCTGGGTCCTCCAGATTATTTTTGTGTCTACTCCTACCCTTATCTACCTGGGCCATGTCCTGCACATTGTGCGAATGGAAGAAAAGAGGAAAGAGAAAGAGGAGGAGCTAAAGAAGTGCATTAAAGGTGCCAGTGAAAAGGAACATTTAATAAAGGGTGGTGAAAAGAAGGAAAAGCCACCTATTAGAGACGAGAGGGGAAAAATCAGGATAGGAGGTGCCCTTCTTCGCACCTATGTCTTTAATATCATCTTCAAGACTTTGTTTGAGATTGGCTTTATTGTAGGACAGTATTTCTTATATGGTTTTCAGCTAAAACCCCTATACAGGTGCAGCCGTTGGCCTTGTCCTAACACCGTGGACTGTTTTATTTCACGGCCAACGGAAAAGACCATTTTTATCATATTTATGCTTGTAGTGGCTTGTGTGTCTCTTTTGCTGAATATGTTAGAGATATATCATCTGGGGTGGAAAAACTCAAGCAGGCATGACAACAGATACATCCCTGATCCTTTCTGCACAATCAGAACCTCCAGCCCTCAACTGCCCATC
                                                  Xt7.1-CHK-1008249348       CAACTTCTGGTACAATTAATTGAGTTCTGTAAGAGTTAACTGCCCAGGGCCTAATGCAGCAAGGTAGCCCAAAACCATATCACTTTCTACACCATGCTTTATGCATTCTCAGCAGTCTCCGAGGGATGCAGGAAATTGTAACTGGAGGGTTGCTGGCCTGACATCCCTGATAGATCGTAAGCCTTCTTCCTCAGTTAGGAATCCGAAACAATGGGCGACTGGAGTTTTCTGGGGAGACTATTGGAAAATGCTCAAGAACACTCAACAGTCATTGGCAAGGTTTGGTTGACAGTGCTCTTTATCTTCCGGATCCTGGTACTGGGAGCTGCAGCAGAGGAGGTTTGGGGGGATGAACAGTCTGACTTCACTTGCAATACGCAGCAACCAGGTTGTGAGAACGTCTGCTATGACAAAGCATTTCCTATTTCTCACATTAGGTTCTGGGTCCTCCAGATTATTTTTGTGTCTACTCCTACCCTTATCTACCTGGGCCATGTCCTGCACATTGTGCGAATGGAAGAAAAGAGGAAAGAGAAAGAGGAGGAGCTAAAGAAGTGCATTAAAGGTGCCAGTGAAAAGGAACATTTAATAAAGGGTGGTGAAAAGAAGGAAAAGCCACCTATTAGAGACGAGAGGGGAAAAATCAGGATAGGAGGTGCCCTTCTTCGCACCTATGTCTTTAATATCATCTTCAAGACTTTGTTTGAGATTGGCTTTATTGTAGGACAGTATTTCTTATATGGTTTTCAGCTAAAACCCCTATACAGGTGCAGCCGTTGGCCTTGTCCTAACACCGTGGACTGTTTTATTTCACGGCCAACGGAAAAGACCATTTTTATCATATTTATGCTTGTAGTGGCTTGTGTGTCTCTTTTGCTGAATATGTTAGAGATATATCATCTGGGGTGGAAAAACTCAAGCAGGCATGACAACAGATACATCCCTGATCCTTTCTGCACAATCAGAACCTCCAGCCCTCAACTGCCCATCTAGCAT
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1
                                               BLH ATG     216     186 
                                               BLH MIN     216      82 
                                               BLH MPR     216      82 
                                               BLH OVR     216     160 
                                               CDS MIN     216      82 
                                               ORF LNG     216      10 
                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 8e-103     AAH43801.1 MGC53082 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 8e-103     NP_001079484.1 similar to gap junction membrane channel protein alpha 3 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 2e-105     AAH74597.1 MGC69466 protein [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 8e-115     NP_068773.2 gap junction protein, alpha 3, 46kDa (connexin 46); gap junction protein, alpha3, 46kD (connexin 46) [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 3e-116     NP_058671.2 gap junction membrane channel protein alpha 3 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 2e-117     NP_001035734.1 gap junction protein, alpha 3, 46kDa (connexin 46) [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 5e-124     NP_997525.1 gap junction membrane channel protein alpha 3 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO5297.5                                           TAA------------TAA---------------------------------------ATG------------------------------------------TAA------------------------------------TAA---------------TAG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2   14  bld Te5  PIPE out                         CAAO466.5p CTCCAACAACTTCTGGTACAATTAATTGAGTTCTGTAAGAGTTAACTGCCCAGGGCCTAATGCAGCAAGGTAGCCCAAAACCATATCACTTTCTACACCATGCTTTATGCATTCTCAGCAGTCTCCGAGGGATGCAGGAAATTGTAACTGGAGGGTTGCTGGCCTGACATCCCTGATAGATCGTAAGCCTTCTTCCTCAGTTAGGAATCCGAAACAATGGGCGACTGGAGTTTTCTGGGGAGACTATTGGAAAATGCTCAAGAACACTCAACAGTCATTGGCAAGGTTTGGTTGACAGTGCTCTTTATCTTCCGGATCCTGGTACTGGGAGCTGCAGCAGAGGAGGTTTGGGGGGATGAACAGTCTGACTTCACTTGCAATACGCAGCAACCAGGTTGTGAGAACGTCTGCTATGACAAAGCATTTCCTATTTCTCACATTAGGTTCTGGGTCCTCCAGATTATTTTTGTGTCTACTCCTACCCTTATCTACCTGGGCCATGTCCTGCACATTGTGCGAATGGAAGAAAAGAGGAAAGAGAAAGAGGAGGAGCTAAAGAAGTGCATTANAGGTGCCAGTGAAAAGGAACATTTAATANAGGGTGGTGAAAAG
  5   1   2      seed Te5       out                        CAAO5297.5p                                                                                                                          CCcagcccatcactaaatggcagctcaagggaaaggatgtaaaaggacaatatttactgatatatatattccagtttggTTAGGAATCCGAAACAATGGGCGACTGGAGTTTTCTGGGGAGACTATTGGAAAATGCTCAAGAACACTCAACAGTCATTGGCAAGGTTTGGTTGACAGTGCTCTTTATCTTCCGGATCCTGGTACTGGGAGCTGCAGCAGAGGAGGTTTGGGGGGATGAACAGTCTGACTTCACTTGCAATACGCAGCAACCAGGTTGTGAGAACGTCTGCTATGACAAAGCATTTCCTATTTCTCACATTAGGTTCTGGGTCCTCCAGATTATTTTTGTGTCTACTCCTACCCTTATCTACCTGGGCCATGTCCTGCACATTGTGCGAATGGAAGAAAAGAGGAAAGAGAAAGAGGAGGAGCTAAAGAAGTGCATTAAAGGTGCCAGTGAAAAGGAACATTTAATAAAGGGTGGTGAAAAGAAGGAAAAGCCACCTATTAGAGACGAGAGGGGAAAAATCAGGATAGGAGGTGCCCTTCTTCGCACCTATGTCTTTAATATCATCTTCAAGACTTTGTTTGAGATTGGCTTTATTGTAGGACAGTATTTCTTATATGGTTTTCAGCTAAAACCCCTATACAGGTGCAGCCGTTGGCCTTGTCCTAACACCGTGGACTGTTTTATTTCACGGCCAACGGAAAAGACCATTTTTATCATATTTATGCTTGTAGTGNCTTGTGTGTCTCTTTTGCTGAATATGTTAGAGATATATCATCTGNNGTGGAAAAAACTTCAGCAAGGCATGACAAACAGATACATCCCTGA
  5   1   2       bld Te5       out                        CAAO9623.5p                                                                                                                                                                                                                                                      ATTGGAAAATGCTCAAGAACACTCAACAGTCATTGGCAAGGTTTGGTTGACAGTGCTCTTTATCTTCCGGATCCTGGTACTGGGAGCTGCAGCAGAGGAGGTTTGGGGGGATGAACAGTCTGACTTCACTTGCAATACGCAGCAACCAGGTTGTGAGAACGTCTGCTATGACAAAGCATTTCCTATTTCTCACATTAGGTTCTGGGTCCTCCAGATTATTTTTGTGTCTACTCCTACCCTTATCTACCTGGGCCATGTCCTGCACATTGTGCGAATGGAAGAAAAGAGGAAAGAGAAAGAGGAGGAGCTAAAGAAGTGCATTAAAGGTGCCAGTGAAAAGGAACATTTAATAAAGGGTGGTGAAAAGAAGGAAAAGCCACCTATTAGAGACGAGAGGGGAAAAATCAGGATAGGAGGTGCCCTTCTTCGCACCTATGTCTTTAATATCATCTTCAAGACTTTGTTTGAGATTGGCTTTATTGTAGGACAGTATTTCTTATATGGTTTTCAGCTAAAACCCCTATACAGGTGCAGCCGTTGGCCTTGTCCTAACACCGTGGACTGTTTTATTTCACGGCCAACGGANAAGACCATTTTTATCATATTTATGCTTGTAGTGGCTTGTGTGTCTCTTTTGCTGAATATGTTAGAGATATATCATCTGGGGTGGAAAAACTCAAGCAGGCATGACAACAGATACATCCCTGATCCTTTCTGCACAATCAGAACCTCCAGCCCTCAACTGCCCATCTAGCATGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)