Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBWN4766.3                            2 END     2          66      100                core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 [Homo sapiens]

 This cluster: approximate FL confidence score = 94%

 1012101262 Xt7.1-CBWN4766.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBWN4766.5 GGCTGTTACCTGAGGGTTTTAACCAGTTTGGTGCCGAGGTGGAGGCAGCAGGCGGAGCCTGGGTTCTCCGGGCAGGTCTATGCTCTGCTGTCAGTGTATTTTAGAGTGACGGAGATAAGGCTCTGCTTTTCCTGTGGGGCTGAAATCCAGCTATGTGAGCGCCACTTCCCCTTCTGCTCTGCTCGCCGGCTTTACCACTGGCAGGGTCTCCGCCGAAATGGCTCCTGCTAAGTCAGTGCTCAGCCTAGCCACCTTCTCGTTTGGGATCGCTATCGGCTTCATCTTCAGCTACGTGATCTTCAGCATAGTGTTTGAGGGACAGGACTCGCCGCAAGGGAAGCCCGAAGTGCTACATAACGACCCCCACGGCAGGCACTCGGATGATGCCCCGGCTGGGCCGCCTCTTCAGGGGCAGATGGACTTCAACGCGGACGCACAGCAGCACCATGATGAGGATACTCATGTGGCTGATGATCTTTATAGCAAAGTGAAAATCTTGTGTTGGGTAATGACAGGCCCTCAGAACCTGGACAAGAAGACCAAGCATGTTAAAGCCACCTGGGCCCAAAGGTGCAACAAAGTGTTATACATGAGCTCGGAAGAGAACAAAGAGTTCCCCACTGTGGGCTTAGATACAAAGGAGGGCAGAGACCAGCTCTATTGGAAACCATTAAAGCCTTTCAGTATGTACACGACCATCATCTGGAGGAAGCTGACTGGTTCATGANAGCAGATGATGATACA
                                                  Xt7.1-CHK-1008251389       TACCTGAGGGTTTTAACCAGTTTGGTGCCGAGGTGGAGGCAGCAGGCGGAGCCTGGGTTCTCCGGGCAGGTCTATGCTCTGCTGTCAGTGTATTTTAGAGTGACGGAGATAAGGCTCTGCTTTTCCTGTGGGGCTGAAATCCAGCTATGTGAGCGCCACTTCCCCTTCTGCTCTGCTCGCCGGCTTTACCACTGGCAGGGTCTCCGCCGAAATGGCTCCTGCTAAGTCAGTGCTCAGCCTAGCCACCTTCTCGTTTGGGATCGCTATCGGCTTCATCTTCAGCTACGTGATCTTCAGCATAGTGTTTGAGGGACAGGACTCGCCGCAAGGGAAGCCCGAAGTGCTACATAACGACCCCCACGGCAGGCACTCGGATGATGCCCCGGCTGGGCCGCCTCTTCAGGGGCAGATGGACTTCAACGCGGACGCACAGCAGCACCATGATGAGGATACTCATGTGGCTGATGATCTTTATAGCAAAGTGAAAATCTTGTGTTGGGTAATGACAGGCCCTCAGAACCTGGACAAGAAGACCAAGCATGTTAAAGCCACCTGGGCCCAAAGGTGCAACAAAGTGTTATACATGAGCTCGGAAGAGAACAAAGAGTTCCCCACTGTGGGCTTAGATACAAAGGAGGGCAGAGACCAGCTCTATTGGAAACCATTAAAGCCTTTCAGTATGTACACGACCATCATCTGGAGGAAGCTGACTGGTTCATGANAGCAGATGATGATACATACGTG
                                                      consensus depths      1     1     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1
                                               BLH ATG     217     141 
                                               BLH MIN     217      34 
                                               BLH MPR     175      34 
                                               BLH OVR     217     599 
                                               CDS MIN     217      34 
                                               ORF LNG     217      20 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 3e-018     XP_798174.1 PREDICTED: similar to core1 UDP-galactose:N-acetylgalactosamine-alpha-R beta1,3-galactosyltransferase (44.1 kD) (3L473), partial [Strongylocentrotus purpuratus] ========================================================================
                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 9e-026     NP_609258.1 CG9520-PB [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 2e-021     AAH73496.1 MGC81025 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-023     NP_499293.2 core1 UDP-galactose:N-acetylgalactosamine-alpha-R beta1,3-galactosyltransferase(44.1 kD) (3L473) [Caenorhabditis elegans] ---------------========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                            PREDICTED - ?? ---- 9e-029     XP_686728.1 PREDICTED: similar to core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 isoform 1 [Danio rerio] -------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                PREDICTED = Dr ==== 6e-030     NP_001070842.1 hypothetical protein LOC557675 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 3e-049     NP_443719.2 core 1 UDP-galactose:N-acetylgalactosamine-alpha-R beta 1,3-galactosyltransferase [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 3e-052     NP_064541.1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                PROTEIN === Gg ==== 1e-058     NP_001012575.1 core1 UDP-galactose:N-acetylgalactosamine-alpha-R beta 1,3-galac [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBWN4766.5           TGA------TAA---------------------------------------------------------ATG------------------------TGA------TAA---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------TGA------ATGATG
                                                                   ORF                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2   10  bld Te1  5g3  out                        CBWN4752.b1 GGCTGTTACCTGAGGGTTTTAACCAGTTTGGTGCCGAGGTGGAGGCAGCAGGCGGAGCCTGGGTTCTCCGGGCAGGTCTATGCTCTGCTGTCAGTGTATTTTAGAGTGACGGAGATAAGGCTCTGCTTTTCCTGTGGGGCTGAAATCCAGCTATGTGAGCGCCACTTCCCCTTCTGCTCTGCTCGCCGGCTTTACCACTGGCAGGGTCTCCGCCGAAATGGCTCCTGCTAAGTCAGTGCTCAGCCTAGCCACCTTCTCGTTTGGGATCGCTATCGGCTTCATC
  5   1   2   10 seed Te1  PIPE out                        CBWN4766.b1 ....GTTACCTGAGGGTTTTAACCAGTTTGGTGCCGAGGTGGAGGCAGCAGGCGGAGCCTGGGTTCTCCGGGCAGGTCTATGCTCTGCTGTCAGTGTATTTTAGAGTGACGGAGATAAGGCTCTGCTTTTCCTGTGGGGCTGAAATCCAGCTATGTGAGCGCCACTTCCCCTTCTGCTCTGCTCGCCGGCTTTACCACTGGCAGGGTCTCCGCCGAAATGGCTCCTGCTAAGTCAGTGCTCAGCCTAGCCACCTTCTCGTTTGGGATCGCTATCGGCTTCATCTTCAGCTACGTGATCTTCAGCATAGTGTTTGAGGGACAGGACTCGCCGCAAGGGAAGCCCGAAGTGCTACATAACGACCCCCACGGCAGGCACTCGGATGATGCCCCGGCTGGGCCGCCTCTTCAGGGGCAGATGGACTTCAACGCGGACGCACAGCAGCACCATGATGAGGATACTCATGTGGCTGATGATCTTTATAGCAAAGTGAAAATCTTGTGTTGGGTAATGACAGGCCCTCAGAACCTGGACAAGAAGACCAAGCATGTTAAAGCCACCTGGGCCCAAAGGTGCAACAAAGTGTTATACATGAGCTCGGAAGAGAACAAAGAGTTCCCCACTGTGGGCTTAGATACAAAGGAGGGCAGAGACCAGCTCTATTGGAAACCATTAAAGCCTTTCAGTATGTACACGACCATCATCTGGAGGAAGCTGACTGGTTCATGANAGCAGATGATGATACATACGTGGTGT
  5   1   2       bld Gas8 5x3  out                         st60k15.5p                                                   GGCGGAGCCTGGGTTCTCCGGGCAGGTCTATGCTCTGCTGTCAGTGTATTTTAGAGTGACGGAGATAAGGCTCTGCTTTTCCTGTGGGGCTGAAATCCAGCTATGTGAGCGCCACTTCCCCTTCTGCTCTGCTCGCCGGCTTTACCACTGGCAGGGTCTCCGCCGAAATGGCTCCTGCTAAGTCAGTGCTCAGCCTAGCCACCTTCTCGTTTGGGATCGCTATCGGCTTCATCTTCAGCTACGTGATCTTCAGCATAGTGTTTGAGGGACAGGACTCGCCGCAAGGGAAGCCCGAAGTGCTACATAACGACCCCCACGGCAGGCACTCGGATGATGCCCCGGCTGGGCCGCCTCTTCAGGGGCAGATGGACTTCAACGCGGACGCGCAGCAGCACCATGGTAACTGGTTAGGCCTGCTGTGTTAGAGATCCCCCCCTTCCCAAAACCCTTATAGCCCCCTCTACTTATCCCACAATTCCCCTACAGCCGGGGGTACCTGGGAGTTATTTGGGGAAGTTCAAGATTTGGGAGGTGCCTTAACCATCACTCTTCTCTAAAACATCACTAAAACATCATTCTGTAAAGGGTTTAAAACAGCTGCAGAACTTTGTGTATAGTGTTTCTATTGCGCCACACAAGCCCCTTCATACTAAGTACTGTAAGTCTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)